Novel therapeutic and diagnostic products and methods

专利摘要:
A method of diagnosing a pI 1/5-HT receptor related disorders in a subject comprising determining the level of p1 1 in a biological sample from said subject and comparing said pl1 level to a reference, wherein an abnormal level of p1 1 compared to the reference constitutes a positive diagnosis of p 1/5-HT receptor related disorder.
公开号:AU2013201088A1
申请号:U2013201088
申请日:2013-02-22
公开日:2013-03-14
发明作者:Paul Greengard；Per Svenningsson
申请人:Rockefeller University；
IPC主号:A61K49-00

专利说明:
AUSTRALIA Patents Act COMPLETE SPECIFICATION (ORIGINAL) Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: The Rockefeller University Actual Inventor(s): Per Svenningsson, Paul Greengard Address for Service and Correspondence: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: NOVEL THERAPEUTIC AND DIAGNOSTIC PRODUCTS AND METHODS Our Ref: 964089 POF Code: 474551/453640 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): 6006q NOVEL THERAPEUTIC AND DIAGNOSTIC PRODUCTS AND METHODS [00011 The present application is a divisional from Australian Patent Application No. 2007258233, the entire disclosure of which is incorporated by reference. 5 [0001a] Australian Patent Application No. 2007258233 claims the benefit of U.S. Provisional Applications 60/813,170 filed June 13, 2006 and 60/878,730 filed January 5, 2007, the contents of which are incorporated herein by reference. TECHNICAL FIELD 10 [00021 The present invention introduces a biological association between pl 1 and 5-HTIB and 5-HT 4 receptors, providing the use of p I1 as a drug target for diseases involving these receptors, as well as a diagnostic tool for the identification of patients suffering from pI 1/5 HT receptor related disorders. 15 BACKGROUND OF THE INVENTION [00031 Currently available anti-depressant and anti-anxiety drugs target the bio-synthetic, degradative and operative pathways of monoamine neurotransmitters such as norepinephrine, dompamine and, in particular, serotonin (5-hydroxy-tryptarnine or 5-HT). Serotonin, first discovered in the late 1940's, plays a crucial role in modulating numerous functions in the 20 body including mood, sleep, appetite and sexual activities. It functions both as a neurotransmitter within the central nervous system and also as a peripheral signal modulator. Consequently, alterations in serotonin availability and activity have been linked to depression, eating disorder (e.g. bulimia), obsessive compulsive disorders (OCD), drug addiction, attention deficit disorder (ADD), attention deficit hyperactive disorder (ADHD), premenstrual 25 syndrome, anxiety disorders, aggression, sleep disorders, sexual dysfunction, gastrointestinal disorders (e.g. irritable bowel syndrome), mania, migrane, and bipolar disorder. Conventional anti-depressants typically regulate the signal transmission by either (1) preventing the degradation of serotonin by inhibiting monoamine oxygenase or (2) increasing neuronal transport of serotonin by inhibiting serotonin re-uptake by the presynaptic neurons. Despite 30 over half a century of intensive study of serotonin pathways, however, the understanding of these pathways is incomplete, and there are no established biochemically-based diagnostics or biomarkers for serotonin pathway dysfunction. 100041 5-HT (serotonin) receptors are heterogeneous and are found on the surface Ia of a variety of cells. The 5-HT1B receptor is one of 14 serotonin receptor subtypes and is found abundantly throughout the central nervous system. The structure, distribution and apparent fumction of 5-HT 1 s receptors are very similar in rodents and humans This receptor has been linked to a diverse range of physiologic functions 5 and behaviors including mood, cognition, aggression, addiction, sleep and feeding. 5 HTiq receptors are found both on serotonin- and nonserotonin-containing neurons. 5 HTIB receptors are found predominantly on the pro-synaptic portion of the neuron, where they function as terminal autoreceptors involved in the regulation of serotonin release by neurons. When stimulated by binding to serotonin, they inhibit the release 10 of additional serotonin by the neuron; when not stimulated, serotonin release is enhanced. Blocking of these 5-HTjs receptors thus tends to enhance serotonin levels. There is some evidence that 5-HTts receptors are heteroreceptors, involved in controlling the release of other neurotransmitters, such as acetylcholine, glutamate, dopamine, norepinepherine and gamma-aminobutyric acid, as well as serotonin. Some 15 5-HT1B receptors are also found post-synaptically. The 5-HT4 receptor is found in the gastrointestinal system, where it Is involved in gastrointestinal motility, as well as the central nervous system. Whereas 5-HTs is generally associated with a decrease In cAMP, the 5-HT 4 receptor is associated with increased cAMP activity. 5-HT4 receptors In the brain modulate neurotransmitter acetylcholinee, dopamine, serotonin 20 and GABA) release and enhance synaptic transmission. They may also play a role in memory enhannement, by promoting release of non-amyloidogenic soluble amylold precursor protein (sAPPalpha). As Alzheimer's disease is widely thought to be mediated by deposition of beta-amyloid plaque formation, enhancing 5-HT4 receptor function, thereby enhancing release of sAPPalpha, represents a potential approach to 25 treatment or prophylads of Alzheimer's disease. 10005 The protein p I is a member of the S100 EP-hand protein family. pi1 is also known as annexin-H light chain, lipocortin-Il light chain, calpactin I light chain, 42C, or S-100 related protein, and these terms may be used interchangeably herein. R. Donato, Blochim. Blophys. Acta, 1450, 191 (1999). It is present in a variety of 30 cells separately or as a heterotetramer. The heterotetramer is composed of two copies of p36, also known as annexin-iI or calpactin-I heavy chain, and two copies of p11. Within the cell, the heterotetramer is localized at the cytoplasmic surface of the plasma membrane in the submembranous cytoskeleton, and it is suggested that the 2 complex may play a role in membrane trafficking events such as exocytosis, endocytosis and cell-cell adhesion, pl 1 has been claimed to have a role in tumor cell invasion, tumor growth, and metastasis. US 2004/0142897A1. p I has not previously been identified as being involved with 5-HT receptors or psychiatric disorders. 5 [0005a] A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims. [0005b] Throughout the description and claims of the specification, the word 10 "comprise" and variations of the word, such as "comprising" and "comprises", is not intended to exclude other additives, components, integers or steps. SUMMARY OF THE INVENTION 100061 Applicants have now surprisingly discovered that pI I protein interacts specifically with 5-HTIB receptors and appears to help regulate signaling of the brain 15 messenger chemical serotonin, a key target of many psychotherapeutic agents. Svenningsson et al., Science (2006) 331:77-80; Svenningsson et al., Current Opinion in Pharmacology (2006), 6:1-6 (both incorporated herein by reference), p 1 I appears to play a crucial role in the recruitment of 5-HTIB receptors to the neuronal plasma membrane where they are more functional. Applicants have further discovered that p11 also interacts with 5-HT 4 receptors. 20 Applicants have shown that p1 1 levels may be directly involved in the development of depression, anxiety disorders and similar psychiatric illnesses that are thought to involve faulty serotonin receptors. Comparison of pl 1 levels in the brains of depressed subjects (depressed humans and mice models) to those of non-depressed subjects (non-depressed humans and control mice) shows a substantially lower level of pl1 in depressed subjects compared to non 25 depressed subjects. Moreover, pl levels tend to be higher in subjects treated with various types of antidepressants, including tricyclic antidepressants, monoamine oxidase inhibitors (MAOIs) and electroconvulsive therapy. There is an over-expression of p1 1 in animals that are treated with anti-depressants. For example, we have observed that monkeys receiving the selective serotonin reuptake inhibitor fluoxetine display a significant (more than twofold) 30 increase in pl 1 expression in peripheral blood mononuclear cells (PBMC), and similar effects are demonstrated in the brains of mice receiving fluoxetine. Similarly, animal models with a p 1 1 knock-out gene exhibit fewer 5-HTlB receptors at the neuronal plasma membrane, have reduced serotonin signaling, and exhibit a depression-like phenotype. Interestingly, p 1 1 3 expression decreases in response to excess levels of glucocorticoid hormones, which are often released in response to stress, which in light of Applicants' work, provides a possible biochemical explanation for the observed link between depression and highly stressful events. Based on these surprising discoveries by Applicants, pl 1 is shown to be a suitable diagnostic 5 target as well as a drug target and screening tool for the development of treatments for disorders previously associated with 5-HTIB or 5-HT 4 receptors, or with serotonin function (or lack thereof). 100071 The term "pl 1/5-HT receptor related disorders" as used herein include any disorders mediated by, associated with, caused by, affected by, triggered by or involving 10 mobilization (or lack of mobilization) of 5-HT receptors, e.g., 5-HTIB or 5-HT 4 receptors, by the pl1 protein, pll/5-HT receptor related disorders may include, but are not limited to, psychiatric disorders (e.g. depression, anxiety disorders, aggression, mania, bipolar disorder, attention deficit disorder, attention deficit hyperactive disorder, drug addiction and obsessive compulsive disorder, and Alzheimer's disease) sleep disorders (e.g. insomnia), eating disorders 15 (e.g. bulimia), sexual dysfunction, and gastrointestinal disorders (e.g. irritable bowel syndrome); especially depression. [00081 The invention thus provides, inter alia: 1. Methods of diagnosing pl1/5-HT receptor related disorders; 2. Methods of identifying compounds useful in treating p l1/5-HT receptor related 20 disorders; 3. Transgenic animals which over- or under-express p11; and 4. Methods of treating pl1/5-HT receptor related disorders. [0008a] In one aspect, the present invention provides a method of diagnosing a pl1/5-HT receptor related disorders in a subject comprising determining the level of pI1 in a biological 25 sample from said subject and comparing said pl1 level to a reference, wherein an abnormal level of pl 1 compared to the reference constitutes a positive diagnosis of pl1/5-HT receptor related disorder. 10008b] In another aspect, the present invention provides a method to identify modulators useful to treat or ameliorate p1 1/5-HT receptor related disorders comprising the steps of: 30 a) providing a first sample and a second sample containing equivalent amounts of pl 1 gene product; b) contacting the first sample with the candidate p I modulator; and 4 c) determining whether the amounts of p1 1 gene product in the first sample has increased or decreased relative to the amounts of p 1 1 gene product in the second sample not contacted with the candidate p 1 1 modulator, wherein an increased amount of gene product indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with 5 abnormally low level of pl 1 while a decreased amount of gene products indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally high level of p11. 10008c] In still another aspect, the present invention provides a method to identify modulators useful to treat or ameliorate pl1/5-HT receptor related disorders comprising the 10 steps of: a) providing a first sample and a second sample containing equivalent number of 5-HTIB receptors at cell surface; b) contacting the first sample with the candidate p 1 1 modulator; and c) determining whether the number of 5-HTIB receptors at cell surface of the first sample has 15 increased relative to the second sample, wherein an increased number of 5-HTB receptors at cell surface indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level of pl 1 activity while a decreased amount of 5-HTIB receptors at cell surface indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally high level of p II activity. 20 10008d] In still another aspect, the present invention provides a method to identify pl1 mimetics useful to treat or ameliorate pl 1/5-HT receptor related disorders comprising assaying for the ability of a candidate p 1 1 mimetic to recruit 5-HTIB receptors to the neuronal plasma membrane. 10008e] In still another aspect, the present invention provides a method of treating or 25 ameliorating p1 dysfunction in a subject diagnosed as suffering from one or more pl 1/5-HT receptor related disorders comprising administering to said subject a therapeutically effective amount of a p1 1 modulator or p 1 1 mimetic. [0008f] In still another aspect, the present invention provides a pl1 knock-out non-human mammal wherein said mammal has a defect, mutation or deficiency in the p 1 1 gene compared 30 to wild-type mammals of the same species. [0008g] In still another aspect, the present invention provides a method of studying p11/5 HT receptor related disorders or to develop novel psychotherapeutic agents useful for the treatment of p1 1/5-HT receptor related disorders comprising: 4a a) administering an effective amount of said psychotropic agent to p 1 1 knock-out mice and control mice; b) assessing the levels of p 1 1 level and/or behavioral responses to said agent in said pl 1 knock-out mice and control mice; 5 c) comparing said pl 1 level and/or behavioral responses in pl1 knock-out mice with control mice. [0008h] In one aspect, the present invention provides a non-human mammal comprising a transgene encoding p 1 under control of a regulatable promoter. DETAILED DESCRIPTION OF THE INVENTION 10 [00091 In one embodiment, the invention relates to a method of diagnosing pl 1/5-HT receptor related disorders in a subject comprising (1) assaying the level of pl1 protein in a biological sample of said subject, e.g., a blood or tissue sample, for example monocytes and/or leukocytes, e.g., peripheral blood mononuclear cells (PBMC), and (2) comparing said pl1 level to a reference standard, e.g., the pl 1 level in a control population that does not have or is 15 not suspected of having any p I1/5-HT receptor related disorders, wherein an abnormal level of pl1 in a subject compared to the reference standard constitutes a positive diagnosis of pl1/5 HT receptor related disorders (Method 1). 4b [0010] Thus the invention includes the following embodiments of Method 1 1.. The method of Method I wherein the p I1/5-HT receptor related disorder is a disorder associated with an abnormally low level of p11, wherein a reduced 5 level of p I in a subject compared to the reference standard constitutes a positive diagnosis of such disorders. 1.2. A method according to method I or 1.1, wherein the disorder is associated with an abnormally low level of p11 and is selected from a group consisting of depression, obsessive compulsive disorder, drug addiction, eating disorders, 10 attention deficit disorder and attention deficit hyperactive disorder. 1.3. A method according to any of the previous methods wherein the disorder is associated with an abnormally low level of p 1 and is depression. 1.4. A method according to method I wherein said p1 1/5-HT receptor related disorders are disorders associated with an abnormally high level of p11, 15 wherein an elevated level of pl I in a subject compared to that of the reference standard constitutes a positive diagnosis of such disorders. 1.5. A method according to any of method 1 or 1.4 wherein the disorder is associated with an abnormally high level of p 1 and is selected from a group consisting of mania, bipolar disorder, anxiety disorders, aggression, sleep 20 disorders, sexual dysfunction and gastrointestinal disorders. 1.6. The method according to any of the foregoing methods wherein said level of pl is determined by assaying pl protein level in peripheral blood mononuclear cells (PBMC) from said subject. 1.7. The method according to 1.6 wherein the PBMCs are selected from 25 monocytes, NK cells, and CD-8+ T-cells. 5 1.8. The method according to any of the foregoing methods, wherein said level of pl t is determined by assaying p1 I mRNA level In a biological sample from said subject. 1.9. The method according to any of the foregoing methods wherein the level of 5 p1 1 is determined using a monoclonal antibody specific for pl1. 1.10. The method according to any of the foregoing methods wherein the p1 I/5-HT receptor related disorder is a p 11/5-HTIs receptor related disorder. 10 1.11. The method according to any of the foregoing methods wherein the p 11/5-HT receptor related disorder is a p 1/5-HT4 receptor related disorder. 1.12. A kit useful in measuring p11 levels, e.g. in accordance with any of the foregoing methods I - 1.11, comprising an oligonucleotide probe specific for p11 mRNA or a monoclonal antibody specific for p11, and instructions for 15 use. 1.13. Use of an oligonucleotide probe specific for p11 mRNA or a monoclonal antibody specific for p11 in any of methods 1 - 1.11. 1.14. Use of an oligonucleotide probe specific for pl I inRNA or a monoclonal antibody specific for p1 in the manufacture of a reagent for use in a method 20 according to any of claims 1-1.11 or In a kit according to 1.12. [00111 In another embodiment, the Invention relates to a method to identify p1 1 modulators useful to treat or ameliorate p 11/5-HT receptor related disorders comprising assaying for the ability of a candidate modulator to regulate 25 (either up or down) p11 expression or p11 activities associated with 5-HT receptors (method 2). (00121 Therefore, method 2 includes 2.1. A method to identify p11 modulators useful to treat or ameliorate p1 1/5-HT receptor related disorders comprises the steps of providing a first sample and a 30 second sample, e.g., a cell culture or cell or tissue sample, containing equivalent amounts of p11 gene product (e.g., protein or mRNA); contacting 6 the first sample with the candidate p11 modulator; and determining whether the amounts of pIl gene product in the first sample has changed, wherein an increased amount of gene product indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level 5 of p1I while a decreased amount indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level of pil. 2.2. A method to identify pI1 modulators useful to treat or ameliorate pI 1/5-HT receptor related disorders comprises the steps of providing a first sample and a 10 second sample containing equivalent number of 5-HTo and/or 5-HT4 receptors at cell surface; contacting the first sample with the candidate p1 I modulator, and determining whether the number of 5-HTwa and/or 5-HT4 receptors at cell surface of the first sample has changed relative to the second sample, wherein an increased number of S-HTB and/or 5-HT4 receptors at cell 15 surface indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level of pl I while a decreased number of 5-HTIS and/or 5-HT4 receptors at cell surface indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level ofpl 1. 20 2.3. A method to identify pIl modulators comprising contacting a candidate p1 modulator with a cell comprising a reporter gene operably linked to a pi1 promoter, and using the reporter gene expression level as a proxy for plI expression. 2.4. A method to identify p1l modulators useful to treat or ameliorate disorders 25 associated with low levels of p11, comprising assaying for the ability of a candidate modulator to up-regulate pl1 expression or increase pIl activities associated with 5-HTIO and/or 5-HT 4 so as to recruit 5-HTIB and/or 5-HT4 receptors at the neuronal plasma membrane. 2.5. A method according to any of methods 2- 2.4 wherein the disorders 30 associated with abnormally low levels of pl I are selected from depression, obsessive compulsive disorder, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder, and Alzheimer's disease. 7 2.6. A method according to any of the preceding methods 2 -2.5 wherein the disorder is depression. 2.7. A method according to any of the preceding methods 2 -2.6 wherein a modulator of p1l is used as a positive control. 5 2.8. A method according to method 2.6 wherein the modulator of p11 is selected fiom tricyclic antidepressants, selective serotonin reuptake Inhibitors, triptans, and monoamine oxidase inhibitors. 2.9. A method according to method 2.8 wherein the modulator of p11 is a tricyclic antidepressant selected from amitriptyline (brand name: Elavil), desipramine 10 (brand name: Norpranin), imipranine (brand name: Tofranil), and nortriptyline (brand name: Aventyl, Pamelor) 2.10. A method according to method 2.8 wherein the modulator of p I is Imipramine. 2.11. A method according to method 2.8 wherein the modulator of p1 lis a 15 Monoamine Oxidase Inhibitors (MAOI), e.g., selected from isocarboxazid (brand name: Marplan); phenelzine (brand name: Nardil) and tranlcypromine (brand name: Parnate) 2.12. A method according to 2.11 wherein the MAOI is tranleypromine. 2.13. A method according to method 2.8 wherein the modulator of p11 is a selective 20 serotonin reuptake inhibitor, e.g., selected from citalopram (brand name: Celexa); escitalopram (brand name: Lexapro); fluoxetine (brand name: Prom); paroxetine (brand names: Paxil, Pexeva); sertraline (brand name: Zoloft). 2.14. A method to identify p1 1 modulators useful to treat or ameliorate disorders 25 associated with high levels of p 1, comprising assaying for the ability of a candidate modulator to down-regulate p11 expression or inhibit or reduce p11 activities associated with 5-HT 1 , and/or 5-HT 4 so as to reduce or inhibit p11's ability to recruit 5-IT 19 and/or 5-HT 4 receptors to neuronal plasma membrane. 30 2.15. A method according to 2.14 wherein the disorders associated with high levels of p I include, but are not limited to mania, dipolar disorder, anxiety disorders, aggression, sleep disorders, sexual dysfunction and gastrointestinal disorders. 8 2.16. A method according to 2.15 to identify p1l modulators useful to treat or ameliorate disorders associated with high levels of p1 1. wherein said modulators are selected from siRNA, antisense oligonucleotides, and monoclonal antibodies to p11. 5 2.17. A method according to any of methods 2-2.16 wherein p11 suppressor compounds selected from siRNA, antisense oligonucleotides, and monoclonal antibodies to p11 are used as controls or comparators. 2.18. A method e.g according to any of method 2-2.17 to Identify p1 mimetics useful to treat or ameliorate disorders associated with abnormally low level of 10 p1, comprising assaying for the ability of a candidate pI mimetic to associate or interact with 5-HTws and/orS-HT4 receptors so as to recruit 5
HT
1 s and/or 5-HT 4 receptors to the neuronal plasma membrane. 2.19. A method according to method 2.18 to Identify p11 mimetics useful to treat or ameliorate depression comprising assaying for the ability of a candidate p11 15 mimetic to recruit 5-HT 1 m and/or 5-HT4 receptors to the neuronal plasma membrane. 2.20. The method according to any of the foregoing methods wherein the p I/S-HT receptor related disorder Is a p 115-HT 1 receptor related disorder. 2.21. The method according to any of the foregoing methods wherein the p11/5-HT 20 receptor related disorder is a p1 1/5-HT 4 receptor related disorder. 2.22. A cell comprising a reporter gene operably linked to a p) 1 promoter. 2.23. Use of a cell according to 2.22 in a method according to any of methods 2 2.21. 25 [00131 In yet another embodiment, the invention is directed to a transgenic non-human mammal or progeny thereof, which over- or underexpresses p1i1, and their use in methods to discover new pharmaceuticals (method 3). The invention thus includes 3.1. A p11 knock-out non-human mammal, wherein said non-hurnan mammal 30 possesses a DNA sequence that has a defect, mutation or deficiency in the p11 gene and therefore under-expresses p11 proteins and/or possesses fewer 5-HT 8 and/or 5-HT 4 receptors at the neumonal plasma membrane and therefore exhibits 9 a depression-like phenotype compared to a wild-type nonhuman mammal of the same species. 3.2. A p11 transgenic non-human mammal, wherein said non-human mammal over exprsses p11 proteins and/or exhibits an elevated level of 5-HTiB and/or 5-HT 4 5 receptors at the neuronal plasma membrane and therefore exhibits a hyperactive phenotype compared to a wild-type non-human mamnal of the same species. 3.3. A non-human mammal according to 3.1 or 3.2 which is.a mouse. 3.4. A non-human manual, e.g. according to 3.2 or 3.3, having a transgene comprising a coding region encoding pil, operably linked to a regulatable 10 promoter, e.g. the doxycycline-regulatable calciun/calmodulin-dependent protein kinase II (CamKII) promoter. 3.5. A method to study p1 1/5-HT receptor related disorders or to develop novel psychotherapeutic agents useful to treat or ameliorate p11/5-HT receptor related disorders comprising (1) administering said agents to (a) pl knock-out 15 mammals according 3.1 or 3.3 and (b) control mammals of the same species that do not have or are not suspected of having any pI 115-HT receptor related disorders; and (2) assessing and comparing the behavior and/or levels of 5-HTis or 5-HT 4 receptor of said (a) knock-out mammals and (b) control mammals. 3.6. A method, e.g. according to 3.4, to study depression comprising administering 20 an antidepressant to (a) p1 I knock-out mammis and (b) control raammals that do not have or is not suspected of having depression; and (2) assessing and comparing the behavior and/or 5-HTIB or 5-HT4 receptor levels of said (a) knock-out mammals and (b) control mammals. 3.7. A p1 1 mouse model useful for developing novel anti-psychotic agents 25 comprising (1) administering said agents to (a) pil over-expressing mice and (b) control mice that do not have or is not suspected of having any p1 1/5-HT receptor related disorders; and (2) aessing and comparing the p11 levels of said (a) transgenic mice and (b) control mice. 3.8. A method to study p1 1/5-HT receptor related disorders or to develop novel 30 psychotherapeutic agents useful to treat or ameliorate p11/5-HT receptor related disorders comprising (1) administering said agents to (a) mammals according 3.2 or 3.3 and (b) control mammals of the same species that do not have or are not suspected of having any p11/5-HT receptor related disorders; and (2) 10 assessing and comparing the p 1 1 levels of said (a) mammals according to 3.2 or 3.3 and (b) control mammals. 3.9. A p11 mouse model useful for developing novel anti-psychotic agents comprising (1) administering said agents to (a) p11 over-expressed mice, eg. 5 according to 32 and (b) control mice that do not have or is not suspected of having any p 11/5-HT receptor related disorders; and (2) assessing and comparing the behavior and/or p11 or S-HT receptor levels of said (a) transgenio mice and (b) control mice. 3.10. The method or model according to any of the foregoing methods or models 10 wherein the 5-HT receptor being measured or being over- or under-expressed is the 5-HT 1 9 receptor. 3.11. The method or model according to any of the foregoing methods or models wherein the 5-HT receptor being measured or being over- or under-expressed Is the 5-HT 4 receptor. 15 (0014] The invention further relates to a method to treat a patient suffering from a p11/5-HT receptor related disorder, comprising administration of a therapeutically effective amount of a p1 1 modulator (method 4). 4.1. Method 4 when the patient is first identified according to any of methods 1 20 1.11. 4.2. Method according to 4 or 4.1 wherein the p1 1/5-HT receptor related disorder is a disorder associated with abnormally low levels of p11. e.g., selected from depression, obsessive compulsive disorder, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder, and 25 Alzheimer's disease. 4.3. Method according to 4.2 wherein the disorder is depression. 4.4. Method according to any of the previous methods 4 -4.3 comprising administration of a pi1 modulator identified in accordance with method 3, e.g. using any of embodiments 3.1 -3.11. 30 4.5. A method according to any of the previous methods wherein the modulator of p il Is selected from tricyclic antidepressants, selective serotonin reuptake inhibitors, and monoamine oxisdase inhibitors. 11 4.6. A method according to method 4.4 wherein the modulator of p11 is a tricyclic antidepressant selected from amitriptyline (brand name: Elavil), desipramine (brand name: Norpramin), imipramine (brand name: Tofranl), and nortriptyline (brand name: Aventyl, Pamelor) 5 4.7. A method according to method 4.5 wherein the modulator of p11 is imipramine. 4.8. A method according to method 4.4 wherein the modulator of pl I Is a Monoamine Oxidase Inhibitors (MAOI) selected from isocarboxazid (brand name: Marplan); phenelzine (brand name: Nardil) and tranicypromine (brand 10 name: Parnate) 4.9. A method according to 4.8 wherein the MAOI is tranleypromine. 4.10. A method according to method 4.4 wherein the modulator of p11 is a selective serotonin reuptake inhibitor selected from citalopram (brand name: Celexa); escitalopram (brand name: Lexapro); fluoxetine (brand name: Proac); 15 paroxatine (brand names: Paxil, Pexeva); sertraline (brand name: Zoloft). 4.11. A method according to any of the previous methods 4-4.10 to treat or ameliorate ia a subject suffering from p1 1/5-HT receptor related disorders comprising administering to said subject an effective amount of pl modulator or mimetic so as to regulate (up or down) p1I expression and/or 5 20 HTra or 5-HT 4 receptors at the neuronal plasma membrane. 4.12. A method according to 4.11 treat or ameliorate in a subject suffering frm disorders associated with abnormally low level of pl I comprising administering to said subject an effective amount of p11 modulator or mimetic so as to up-regulate p11 expression or recruit 5-HTIs or 5-HT4 receptors to the 25 neuronal plasma membrane. 4.13. A method according to 4.12 wherein the disorder is selected from depression, obsessive compulsive disorder, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder, and Alzheimer's disease. 30 4.14. The method according to any of the foregoing methods wherein the p 11/5-HT receptor related disorder Is a pi 1/5-HT 1 9 receptor related disorder. 4.15. The method according to any of the foregoing methods wherein the p 11/5-HT receptor related disorder is a p 11/5-HT 4 receptor related disorder. 12 4.16. The use of a p11 modulator, e.g., as herein described, in the manufacture of a medicament to treat a pl /5-HT receptor media disorder, e.g., in any of methods 4 -4.15. 4.17. A pharmaceutical composition comprising a pil modulator for use in treating 5 a phl / 5-HT receptor mediated disorder, e.g., in any of methods 4 -4.15. [0015] In another embodiment, the invention relates to a method to enhance piI expression or upregulate ptI in a patient suffering from a ph 1/5-HT receptor related disorder, comprising the administration of a nucleic acid expressing pI1 or 10 inducing the expression of plI in the brain of said patient, wherein said nucleic acid up-regulates p11 or increases p11 expression in the brain of said patient (Method 5). Ie nucleic acid encoding or inducing the expression of pl1 is preferably delivered to the brain of the patient by a vector or by cells comprising the nucleic acid. Such vectors may be in the form of DNA or RNA in a suitable delivery system, for 15 example liposome-encapsulated DNA constructs or in the form of a viral vector, for example a replication deficient adenoviral vector or adeno-associated viral vector. In a preferred embodiment, the vector is a viral vector which provides transient expression of the desired transgene rather than integration of the transgene into the infected cell, for example a vector derived from adenovirus. The vector may for 20 example comprise DNA encoding pl1 operably linked to a promoter, e.g., a constitutive promoter (e.g., such as the CMV promoter), a tissue-specific promoter (e.g., such as the neuron-specific enolase (NSE) prontoter) or an inducible promoter (e.g., a tetracycline or doxycycline inducible promoter), that controls the expression of the DNA encoding p1 I so as to enable the expression of p I In the target cell. For 25 example, a viral vector may be a recombinantly modified adenovinms comprising a pl I DNA construct under control of a tissue-specific promoter and lacking a functional copy of one or more genes essential for replication (for example, the El and/or E3 gene), such that the virus can replicate only in a helper cell line or other environment where the product of the gene or genes essential for replication is 30 supplied. Viral vectors may also comprise surface modifications to reduce immunogenicity and/or to target the vectors to the desired cells. Viral vectors suitable for gene therapy in the CNS are known in the art, e.g., including vectors targeted to CNS cells and vectors utilizing tissue specific or inducible promoters for expression 13 of the transgene, for example as described in Benitez, et al., "Gene Therapy Targeting in Central Nervous System", Current Gene Therapy (2003) 3: 127-145 (incorporated herein by reference). Non-viral nucleic acid delivery systems may comprise nucleic acid associated or complexed with agents to facilitate the entry of 5 the nucleic acid across the cellular membrane. Examples of such non-viral vector complexes Include the formulation with polycationic agents which facilitate the condensation of the DNA and lipid-based delivery systems, for example a liposome based delivery system. In another embodiment, said nucleic acid expressing or inducing the expression of p11 is delivered by a cell, for example a neuronal stem cell 10 which expresses p11 at levels higher than the levels expressed by the patient's cells, which is transplanted into the brain of the patient. The source of the cell may be the patient or a humnn donor. The p11 expression in the transplanted cell may be achieved by selection for p11 expression and/or by transformation, e.g., ex vivo transformation, with (I) a p11 construct, (ii) a promoter upstream of the native p i 15 sequence which enhances p11 expression, or (iii) a construct encoding a protein which enhances p11 expression. The cell is preferably stably transformed, e.g., using a retroviral or lentiviral vector, so that the construct is Integrated into the genome of the cell. The cellular or viral vectors may further comprise a "safety gene" for example the herpes simplex virus thymidine kinase gene (HSV-t*) which makes a 20 host cell susceptible to gancyclovir, so that the cells or vinises can be easily destroyed if the cells become cancerous or the virus infects the patient or there Is otherwise a risk of harm to the patient In a preferred embodiment, the nucleic acid enhancing pi1 expression (for example a cell or viral vector comprising a construct expressing p11) is introduced into the targeted cell via intracerebral administration, e.g., into the 25 hippocampus region. The nucleic acid may be administered in a single dose or a multiplicity of treatments. [0016] Therefore, the invention further provides methods as follows: 5.1 Method 5, wherein said method increases p11 expression. 5.2 Method 5 or 5.1, wherein the nucleic acid construct is capable of 30 expressing pl1 in a brain celL 5.3 Method 5, 5.1-5.2, wherein the p1 115-HT receptor related disorder is a disorder associated with abnormally low levels of pl , e.g., selected from depression, obsessive compulsive disorder, drug addiction, eating 14 disorders, attention deficit disorder or attention deficit hyperactive disorder, and Alzheimer's disease. 5.4 Method 5, 5.1-5.2, wherein the pl 1/5-HT receptor related disorder is anxiety disorder or depression. 5 5.5 Method 5, 5.1-5.2 wherein the pl1/5-HT receptor related disorder is depression. 5.6 Method 5, 5.1 or 5.5, wherein said nucleic acid encoding p11 is delivered by a replication-deficient adenoviral vector comprising DNA encoding p11. 10 5.7 Method 5.6, wherein the DNA encoding pI1 is under control of a tissue specific promoter, for example the NSE promoter. 5.8 Method 5, 5.1 or 5.5, wherein said nucleic acid encoding p11 is delivered by a stem cell transformed with a pI1 construct. 5.9 Any of Methods 5 or 5.1-5.8, wherein said nucleic acid of pl 1 is 15 introduced via intracerebral administration. 5.10 Any of methods 5 or 5.1-5.8, wherein said nucleic acid of pl 1 is introduced to the hippocampus. [00171 As used herein and in the appended claims, the singular forms " "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, 20 for example, reference to the "antibody" is a reference to one or more antibodies and equivalents thereof known to those skilled in the art, and so forth. Treatment of "a" p11 /5-HT11 receptor mediated disorder may include treatment of multiple such disorders. [0018] The term "p1 1" herein refers to any and all forms of pl 1 polypeptide, 25 including but not limited to, partial forms, Isoforms, precursor forms, full length polypeptide, fusion proteins containing the p1l sequence or fragments of any of the above, from human or any other species. [00191 The phrase "p1 1/5-HT receptor related disorders" herein refers to any disorders mediated by, associated with, caused by, affected by, triggered by or 30 involving p11 protein and its mobilization of 5-HT receptors, especially the 5-HTa or 5-HT 4 receptors. pl 1/5-HT receptor related disorders may include, but are not limited to, psychiatric disorders (e.g. depression, anxiety disorders, aggression, mania, bipolar disorder, attention deficit disorder, attention deficit hyperactive disorder, Alzheimer's 15 disease, drug addiction and obsessive compulsive disorder) sleep disorders (e.g. insomnia), eating disorders (e.g. bulimla), sexual dysfinction, and gastrointestinal disorders (e.g. irritable bowel syndrome). "Disorders associated with abnormally low level of p11" herein refers to disorders such as depression, obsessive compulsive 5 disorders, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder, or Alzheirer's disease, especially depression. Likewise, "disorders associated with abnormally high level of p11" refers to disorders such as mania, dipolar disorder, anxiety disorders, aggression, sleep disorders, sexual dysfunction and gastrointestinal disorders. 10 {00201 The phrase "pIl modulator'refers to any substance or compound (e.g. small molecules or polypeptides as described herein) or methods of treatment (e.g., electroconvulsive therapy) capable of changing (either increasing or decreasing) expression of a gene encoding p11 protein, transcription of a p1I gene or cDNA into an mRNA, the translation of a p11 mRNA into protein, post-translational. 15 modification of a p II protein, cellular or extracellular localization of a pI1 protein, or amount of p11 localized in or on the cell membrane or inside the cell, relative to the pII activity in similar cells. The term "p1l modulator" also refers to any substance capable of affecting (either positively or negatively) the ability ofpl I proteins to recruit 5-HT 1 s receptors to the neuronal plasma mernbrane. Examples of pl 1 20 modulators useful to treat disorders associated abnormally low level of p11 such as depression include tricyclic antidepressants (e.g. Imipramine (Tofranil@), amitriptyline (ELAVIL@A, ENDEP@ TRYPTANOL@), clomipramine (ANAFRANIL@), desipramine (NORPRAMIN@, PBRTOFRANB@), lofeprarnine (GAMANIL@, LOMONT@), nortriptyline (PAMBLOR@), trimipramine 25 (SURMONTIL@)). Other modulators useful to treat or ameliorate disorders associated with low level of pl I (e.g. depression) include Monoamine Oxidase Inhibitors (MAO1) (e.g. Tranylcypromine (Parnate), Isocarboxazid (Marplan), Moclobemide (Aurorix, Manerix, MOCLODURA@) or Pheneizine (Nardil)), and selective serotonin reuptake inhibitors (e.g., citalopram (brand name: Celexa); 30 esoitalopram (brand name: Lexapro); fluoxetine (brand name; Prozac); paroxetine (brand names: Paxil, Pexeva); sertraline (brand name: Zoloft)). 16 [00211 Conventional screening assays (both In vitro and in vivo) may be used to Identify modulators that inhibit or induce pI1 activity and/or p 1 1 gene expression. One such assay Is a gene reporter assay, wherein cells trensfected with a reporter construct comprising a marker gene (e.g., luciferase or green fluorescent protein 5 (GFP)) downstream of a p1 binding site are contacted with a candidate modulator compound and the changes in the expression of the marker protein is measured and compared to a transfected cell sample that Is not contacted with any modulator. Candidate modulators that either inhibit or induce marker protein expression are identified as drugs useful for the treatment of p1 1/5-HT receptor related disorder. 10 Candidate modulators that inhibit marker protein expression would be useful drug ca e for the treatment of disorders associated with abnormally high level of p 1 while a candidate modulators that induce marker protein expression would be useful drug candidates for the treatment of disorders associated with abnormally low level of p 1 1 . 15 (00221 p11 modulators may include, e.g., natural or unnatural chemical compounds, in free or pharmaceutically acceptable salt form, sense or antisense p 1 I oligonucleotides, inhibitory antibodies to p11, p lI-receptor blocking peptides, pl I antagonists, si RNA, triple helix DNA, ribozymes, RNA aptamers and/or double stranded RNA. The term "antisense" as used herein, refers to nucleotide sequences 20 which are complementary to a specifc DNA or RNA sequence. Therefore, "pl 1 antisense polynucleotide" refers to any nucleotide sequence that is complementary to p11 DNA or RNA sequence. Functionally, p11 antisense polynucleotide is capable of decreasing the expression of p1 I protein in a cell. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense' strand. 25 Antisense molecules may be produced by any method, including synthesis by ligating the gene(s) of interest in a reverse orientation to a viral promoter which permits the synthesis of a complementary strand. Once introduced Into a cell, this transcribed strand combines natural sequences produced by the cell to form duplexes. These duplexes then block either the further transcription or translation. The designation 30 "negative" is sometimes used in reference to the antisense strand, and "positive" is sometimes used in reference to the sense strand. Similarly, the term "sense" as used herein, refers to nucleotide sequences which can be translated to produce a specific polypeptide or fragment thereof. Therefore, "p11 sense polynucleotide" refers to any 17 nucleotide sequence that can be translated to produce pi1 polypeptide or fragment thereof Functionally, p11 sense polynucleotide is capable of increasing the expression of p11 proteins in a cell. [0023] Specifically, substances that inhibit the expression of p1 I at the nucleic 5 acid level may include ribozymes, antisense oligonucleotides, triple helix DNA, RNA aptamers and/or double stranded RNA directed to an appropriate nucleotide sequence of the pl I nucleic acid. These inhibitory molecules may be created using conventional techniques by one of skill in the art without undue burden or experimentation. For example, modifications (e.g. Inhibition) of gene expression can 10 be obtained by designing antisense molecules, DNA or RNA, to the control regions of the genes encoding the polypeptides discussed herein, i.e. to promoters, enhancers, and introns. For example, oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site may be used. Notwithstanding, all regions of the gene may be used to design an antisense molecule 15 in order to create those which gives strongest hybridization to the mRNA and such suitable antisense oligonucleotides may be produced and identified by standard assay procedures familiar to one of skill In the art 10024] Similarly, inhibition of the expression of gene expression may be achieved using "triple helix" base-pairing methodology. Gee, J.E. et al. (1994) In: 20 Huber, B.E. and B. 1. Car, Molecular and nmrmologic Approach.,, Futura Publishing Co., Mt. Kisco, N.Y.). These molecules may also be designed to block translation of mnRNA by preventing the transcript from binding to ribosomes. Ribozymes, enzymatic RNA molecules, may also be used to inhibit gene expression by catalyzing the specific cleavage of RNA. The mechanism of ribozyme action 25 involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples which may be used include engineered "hammerhead" or "hairpin" motif ribozyme molecules that can be designed to specifically and efficiently catalyze endonucleolytic cleavage of gene sequences, for example, the gene for pl1. Specific ribozyme cleavage sites within any 30 potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, OUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides consponding to the region of the target gene containing the cleavage site may be 18 evaluated for secondary structural feanues which may render the oligonucleotide inoperable. Grassi and Marini, 1996, Anjals of Medicine 28: 499-510; Gibson, 1996, Cancer and Metastasis Reviews 15: 287-299; Cotten at al., 1989 EMBO . 8:3861 3866. RNA aptamers can also be introduced into or expressed in a cell to modify 5 RNA abundance or activity. RNA aptamers are specific RNA ligands for proteins, such as for Tat and Rev RNA (Good et al., 1997, Gene Therapy 4: 45-54) that can specifically inhibit their translation. Gene specific inhibition of gene expression may also be achieved using conventional double stranded RNA technologies. A description of such technology may be found in WO 99/32619 which is hereby 10 incorporated by reference in its entirety. [0025] Antisense molecules, triple helix DNA, RNA aptamers and ribozymes of the present invention may be prepared by any method known in the art for the synthesis of nucleic acid molecules. These include techniques for chemically synthesizing oligonucleotides such as solid phase phosphoramidite chemical 15 synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the genes of the polypeptides discussed herein. Such DNA sequences may be Incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as 7 or SP6. Alternatively, cDNA constructs that synthesize antisense RNA constitutively or inducibly can be 20 introduced into cell lines, cells, or tissues. [0026] siRNA molecules of the present invention can be generated by annealing two complementary single-stranded RNA molecules together (one of which matches a portion of the target mRNA) (Fire at al., U.S. Pat. No. 6,506,559) or through the use of a single hairpin RNA molecule that folds back on itself to produce the requisite 25 double-stranded portion (Yu et al. (2002) Proc. Natl. Acad. Sci. USA 99:6047-52). The siRNA molecules can be chemically synthesized (Elbashir et al. (2001) Nature 411:494-98) or produced by in vitro transcription using single-stranded DNA templates (Yu et al., supra). Alternatively, the sIRNA molecules can be produced biologically, either transiently (Yu et al., supra; Sul et al. (2002) Proc. Nat. Acad. 30 Sci. USA 99:5515-20) or stably (Paddison et al. (2002) Proc. Nat. Acad. Sci. USA 99:1443-48), using an expression vector(s) containing the sense and antisense sIRNA sequences. Recently, reduction of levels of target mRNA in primary human cells, in an efficient and sequence-specific manner, is demonstrated using adenoviral vectors 19 1hat express hairpin RNAs, which are itrther processed into siRNAs (Arts et al. (2003) Genome Res. 13:2325-32). 100271 As used herein, the phrase "p11 activities" refers to any direct biochemical activity of pl I or indirect activity associated with p11 so as to affect 5 (positively or negatively) p11 's interaction with 5-HT~s receptors. Modulators that increase p11 activities with 5-HTIa receptors may be any substance that increases the association of pi Ito 5-HTIa receptors so as to increase the ability of p11 proteins to recruit 5-HT, 8 receptors to the neuronal plasma membrane. Conversely, modulators that inhibit or reduce p11 activities with 5-HTIB receptors may be any substance that 10 blocks or reduces the Interaction between pi1 and 5-HTIB receptors so as to reduce the ability of pl I proteins to recruit 5-HT,, receptors to the neuronal plasma membrane. (0028 The term "p11 mimetic" refers to a natural or unnatural substance or polypeptide or any fragment thereof that mimics p II protein in structure, function, 15 property and/or activity, thereby modilating, regulating or Increasing 5-HTlB receptor availability at the neuronal plasma membrane. pi lmimetic may mimic pI1 in whole or in part. [0029) The term "subject" refers to any human or nonhuman organism. [0030] A "control subject" refers to any human or nonhunan organism that 20 does not have and/or is not suspected of having a disorder, syndrome, disease, condition and/or symptom of p 115-HT receptor related disorders. 10031] The term "biological sample" may include any sample comprising biological material obtained from e.g. an organism, body fluid, waste product, cell or part of a cell thereof, cell line, biopsy, tissue culture or other source containing a p 1 25 protein, polypeptide, oligonucleotide, mRNA or polynucleotide or any fragment of any of the above. [00321 A "positive diagnosis" of a p1 1/5-HT receptor related disorder refers to a condition where the subject being examined exhibits an abnormal level of p I compared to control subject who does not have and/or is not suspected of having a 30 p11/5-HT receptor related disorder. Abnormal level refers to a level that Is higher or lower than that in a control subject. For instance, a subject with a positive diagnosis of depression exhibits a depressed level of p11 compared to a control subject who does not have and/or is not suspected of having depression and/or symptom thereof. 20 On the oier hand, a subject with a positive diagnosis of anxiety disorders state exhibits an elevated p11 expression compared to a control subject who does not have and/or is not suspected of having anxiety disorders and/or symptom thereof. [0033] The level of plI may be determined by assaying p11 proteins in a 5 sample of tissue or cells obtained from a subject of a type which expresses p11. For example, monocytes and/or lymphocytes may be used. Similarly, pI1 level may also be determined by assaying for p11 mRNA level in the sample. p1 I gene expression (e.g. mRNA levels) may be determined using methods familiar to one of skill in the art, including, for example, conventional Northem analysis or commercially available 10 micro-arrays. Additionally, the effect of test compounds' inhibition of pII and/or related regulatory protein levels can be detected with an BLISA antibody-based assay or fluorescent labeling reaction assay. An abnormal level of p I protein or mRNA In a subject compared to a reference, e.g., a control subject or control population (or a reference standard based on prior measurements In a control population) constitutes a 15 positive diagnosis of pI 1/5-HT receptor related disorders. Therefore, an elevated level of p11 in a subject compared to the reference constitutes a positive diagnosis of disorders associated with high levels of pl 1, e.g. mania, dipolar disorder, anxiety disorders, aggressive disorder, sleep disorders, sexual dysfunction and gastrointestinal disorders (e.g. IBD). On the other hand, a depressed or reduced level of pl I In a 20 subject compared to that in a control subject constitutes a positive diagnosis of disorders associated with low levels of p 11, e.g. depression, obsessive compulsive disorders, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder. In a preferred embodiment, the invention encompasses a method of diagnosing in a subject suffering from depression, comprising assaying pl1 25 level in said subject and comparing such level to the pi level in a control subject, wherein a depressed level of p11 in said subject compared to that in a control subject constitutes a positive diagnosis of depression. 100341 As used herein, the term "antibody" refers to intact molecules as well as fragments thereoft such as Fa, F(ab') 2 , and Fv, which are capable of binding the 30 epitopic determinant Antibodies that bind p1I polypeptides can be prepared using intact polypeptides or fragments containing small peptides of interest as the immunizing antigen. The polypeptides or peptides used to immunize an animal can be derived from the translation of RNA or synthesized chemically, and can be 21 conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin. Tle coupled peptide Is then used to immunize an animal (e.g., a mouse, a rat or a rabbit). [00351 Factors for consideration for optimizing a therapy for a patient include 5 the particular condition being treated, the particular mammal being treated, the clinical condition of the individual patient, the site of delivery of the active compound, the particular type of the active compound, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The therapeutically effective amount of an active compound to be administered will 10 be governed by such considerations, and is the minimum amount necessary for the treatment of pl1 mediated disorders, preferably, depression. 100361 Suitable antibodies to pI1 or related regulatory proteins can be obtained fiom a commercial source or produced according to conventional methods. For example, described herein are methods for the production of antibodies capable of 15 specifically recognizing one or more differentially expressed gene epitopes. Such antibodies may include, but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') 2 fragments, fragments produced by a Fab expression library, anti idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. 20 [0037] For the production of antibodies to phl polypeptides discussed herein, various host animals may be immunized by injection with the polypeptides, or a portion thereof. Such host animals may include, but are not limited to, rabbits, mice, and rats. Various adjuvants may be used to increase the immunological response, depending on the host species, including, but not limited to, Freund's (complete and 25 Incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmctte-Ouerin) and Corynebacterium parvum. [00381 Polyclonal antibodies are heterogeneous populations of antibody 30 molecules derived from the sera of animals immunized with an antigen, such as target gene product, or an antigenic functional derivative thereof. For the production of polyclonal antibodies, host animals such as those described above, may be immunized 22 by injection with the polypeptides, or a portion thereof, supplemented with adjuvants as also described above. 100391 Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, may be obtained by any technique which provides 5 for the production of antibody molecules by continuous cell lines in culture, such techniques being well known in the art. Such antibodies may be of any hnmunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof, preferably IgG. The hybridoma or transformed cell line producing the mAb of this invention may be cultivated in vitro or in vivo. Alternatively, techniques described for 10 the production of single chain antibodies can be adapted to produce differentially expressed gene-single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. [0040] Detection of the antibodies described herein may be achieved using 15 standard ELISA, FACS analysis, and standard imaging techniques used In vitro or in vivo. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include 20 horseradish peroxidase, alkaline phosphatase, 3- galactosidse, or acetyicholinesterase; examples of suitable prosthetic group complexes include streptavidin/blotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein Isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a 25 luminescent material includes luminol; examples of bioluminescent materials include luelferase, luciferin, and aequorin, and examples of suitable radioactive material include 251, 13Is sS or 3 H. (00411 For examrnple, In a typical forward assay, unlabeled antibody Is immobilized on a solid substrate and the sample to be tested brought into contact with 30 the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-antigen binary complex, a second antibody, labeled with a reporter molecule capable of inducing a detectable signal, Is added and incubated, allowing time sufficient for the formation of a ternary complex 23 of antibody-antigen-labeled antibody. Any un-reacted material is then washed away, and the presence of the antigen is determined by observation of a signal, or may be quantified by comparing with a control sample containing known amounts of antigen. Variations on the forward assay include the simultaneous assay, in which both sample 5 and antibody are added simultaneously to the bound antibody, or a reverse assay in which the labeled antibody and sample to be tested are first combined, incubated and added to the unlabeled surface bound antibody. These techniques are well known to those skilled in the art, and the possibility of minor variatidas will be readily apparent. As used herein, "sandwich assay" Is intended to encompass all variations on the basic 10 two-site technique. For the immunoassays of the present invention, the only limiting factor is that the labeled antibody be an antibody which is specific for the p11 polypeptide or related regulatory protein, or fragments thereof. [0042] The most commonly used reporter molecules are either enzymes, fluorophore- or radionuclide-containing molecules. In the case of an enzyme 15 immunoassay an enzyme is conjugated to the second antibody, usually by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different ligation techniques exist, which are well-known to the skilled artisan. Commonly used enzymes Include horseradish peroxidase, glucose oxidase, beta galactosidase and alkaline phosphatase, among others. The substrates to be used with 20 the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable color change. For example, p-nitrophenyl phosphate Is suitable for use with alkaline phosphatase conjugates, for peroxidase conjugates, 1,2-phenylenediamine or toluidine are commonly used. It is also possible to employ fhiorogenic substrates, which yield a fluorescent product rather than the 25 chromogenic substrates noted above. A solution containing the appropriate substrate is then added to the tertiary complex. The substrate reacts with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an evaluation of the amount of polypeptide or polypeptide fragment of interest which is present in the serum sample. 30 10043] Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labeled antibody absorbs the light energy, inducing a state of 24 excitability in the molecule, followed by emission of the light at a characteristic longer wavelength. The emission appears as a characteristic color visually detectable with a light microscope. Immunofluorescence and BIA techniques are both very well established in the art and are particularly preferred for the present method. However, 5 other reporter molecules, such as radloisotopes, chemiluminescent or bioluminescent molecules may also be employed. It will be readily apparent to the killed artisan how to vary the procedure to suit the required use. 10044] When the antibodies are intended for therapeutic use, it is preferred that they have a human constant region so as to minimize their immunogenicity. Chimeric 10 antibodies are made by splicing DNA encoding the variable region from a donor antibody molecule of appropriate antigen specificity together with DNA encoding the constant region of a human antibody molecule. The antibodies may be further modified to provide humanized antibodies, which are additionally modified to remove nonhuman residues. For the most part, humanized antibodies are human 15 immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human 20 residues. The humanized antibody may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions 25 correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region or domain (Fe), typically that of a human immunoglobulin. Alternatively, antibodies derived from nonhuman sources but using 30 filly human immunoglobulin genes may be made e.g., using phage display techniques or transgenic animals, e.g., transgenlc mice having human IgV and IgC genes, and such antibodies should exhibit minimat humunogenicity. 25 (0045] A "therapeutically effective amount" as used herein refers to an amount of drug sufficient to treat or ameliorate the pathological effects of pl 115-HT receptor related disorders. For instance, a therapeutically effective amount of pl I modulator sufficient to treat or ameliorate the pathological effets of a pI 1/5-HT receptor related. 5 disorder is an amount sufficient to either induce or inhibit p11 expression or regulate (either up or down) 5-HTa receptors levels at the neuronal plasma membrane. Therefore, a therapeutically effective amount of p11 modulator sufficient to treat or ameliorate the pathological effects of depression is an amount sufficient to either induce p11 expression or increase p11's ability to recruit S-HTla receptors to the 10 neuronal plasma membrane. Conversely, a therapeutically effective amount of pI l modulator sufficient to treat or ameliorate the pathological effects of anxiety disorders would be an amount sufficient to either inhibit p11 expression or down-regulate 5
HT,
8 receptors at the neuronal plasma membrane. p 1 1 modulator may be administered via known methods in the art Including intravenous, subcutaneous, 15 intramuscular, transdermal or intracerebral administration. Administration may be rapid as by injection or over a period of time as by slow infusion or administration of a slow release formulation. [0046] The phrase "p I knock-out" refers to a DNA sequence that has a total or partial defect, alteration or mutation or is devoid or deficient in the pi gene. A "p11 20 knock-out mouse" or "pI knock-out transgenic mouse" therefore refers to a mouse wherein the DNA introduced into said mouse contains a defect, deficiency, mutation or alteration in the gene that expresses p11 proteins. As a result of the defect or deficiency in p1l gene, a p1l knock-out mouse has fewer 5-HTo receptors at the neuronal plasma membrane and/or exhibits reduced or no 5-HTis receptors at the 25 neuronal plasma membrane, thereby exhibiting a depression-like phenotype compared to wild-type mouse. The terms "knock-out" may refer to a deviation anywhere from 1 nucleotide to deletion of the entire gene compared to the original gene. Knock-out mice may be generated by using any known techniques in the art such as targeted homologous recombination. 30 10047] The term "recombinant" refers to DNA which has been isolated from its native or endogenous source and modified either chemically or enzymatically to delete naturally-occurring flanking nucleotides or provide fRanking nucleotides that do 26 not naturally occur. Flanking nucleotides are those nucleotides which are either upstream or downstream from the described sequence or sub-sequence of nucleotides. 100481 As used herein, a "vector" is something which delivers a recombinant nucleic acid to a desired cell or tissue, for example a virus which can infect, transfect, 5 or transiently or permanently transduce a cell. It is recognized that a vector can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid. The vector optionally comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a viral lipid envelope, etc.). For purposes of this application, a vector may also be a cell comprising the recombinant nucleic acid. It is 10 recognized that vectors typically include an expression cassette placing the nucleic acid of interest under the control of a promoter, or may simply include a promoter flanked by targeting sequences to achieve Insertion upstream of the gene whose expression is desired. Vectors include, but are not limited to replicons (e.g., plasmids, bacteriophages) to which fragments of DNA may be attached and become replicated. 15 Vectors thus include, but are not limited to RNA, autonomous self-replicating circular DNA (plasmids), and include both the expression and nonexpression plasmids. Where a recombinant microorganism or cell culture is described as hosting an "expression vector" this includes both extrachromosomal circular DNA and DNA that has been incorporated into the host chromosome(s). Where a vector is being maintained by a 20 host cell, the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or may be incorporated within the host's genome. [0049) The phrase nucleicc acid sequence encoding" refers to a nucleic acid containing codons which, when transcribed and/or translated, express a specific protein or peptide. The nucleic acid sequence may additionally comprise flanking 25 sequences, introns, and/or sequences encoding peptides which are subsequently cleaved post-translation. The nucleic acid sequences include both the DNA strand sequence that Is transcribed Into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the fuil length sequences. 30 It being further understood that the sequence includes the native sequence as well as sequences utilizing degenerate codons, e.g., to adapt the sequence to the codon preference in a specific host cell. 27 [0050] "Nucleic acids", as used herein, may 1e DNA or RNA. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase and do not alter expression of a polypeptide encoded by that nucleic acid. 5 EXAMPLES Example 1-Yeast Two-Hybrid Screen. (00511 To better understand the function of 5-HTs receptors, the third 10 intracellular loop of this receptor is used as bait in a yeast two-hybrid screen. The third intracellular loop of the rat 5-HTIB receptor (amino acids 226-311) is PCR amplified from a the full-length cDNA rat brain library and subcloned into the Nco I/Sal sites of a bait pAS2-derived vector, for expression as a GALA DNA-binding domain Musion protein. The 5-HTIB receptor-bait plasmid is transformed, by using the 15 lithium acetate method, Into yeast strain C01945. The size and expression level of the fusion protein are checked by Immunoblot by using an anti-GAL4 DNA binding domain antibody. The pact rat brain cDNA library Is transformed into yeast strain Y1 87. Bait and prey transformants are mated on YPD medium and plated on medium (-LWH) selective for the expression of the histidine reporter gene. 244 x 106 diploid 20 clones from the pact rat brain cDNA library are screened. After growth on this medium, a 5-bromo-4-chloro-3-indoly -D-galactoside overlay assay is performed. Moe than 300 clones grow on selective medium and are positive for the 0 galactosidase reporter gene. Yeast extracts are prepared from double positive clones. Prey inserts are amplified by PCR (5'-CGCG1TOGAATCACTACA GGGATG-3' 25 and 5 '-GAAATrGAGATOGTGCACGATGCAC-3') and sequenced using a prey vector oligonucleotide (5'- GGCTIACCCATACOATOTTC-3'). pl is identified as the major prey by a BLAST search. pI1 prey plasmid clones are selectively rescued from the yeast, transformed into Escherichta coUl for DNA amplification and retransformed into the yeast strain Y187 with (I) the original 5-HTi 13 receptor-bait 30 vector, (II) the bait control vector to test for transactivation, (11) two other irrelevant bait constructs, pRP21 and CA 125, or (Iv) bait constructs corresponding to the third intracellular loops of 5-HT1A, 5-HT2A, 5-HT5A, 5-HT6, DI or D2 receptors, to test the specificity of the interaction. The baits corresponding to 5-HTIA (amino acids 218-345), 5-HT2A (amino acids 236-302), 5-HTSA (amino acids 233-295), 5-HT 6 28 (amino acids 209-265), DI (amino acids 256-312) and D2 (amino acids 211-343) receptors, respectively, are made by PCR'amplification from the rat brain cDNA library and subcloning into the pAS2- derived vector. Each of these baits is co transformed into yeast with the p11 prey construct and the interaction analyzed by 5 using -LW or -LWH medium and an X-gal overlay asy. All the co-transformants grew on the non-selective medium (-LW) control plates. On the selective medium ( LWH), a positive interaction of p11 with 5-HT1B receptors, but not with any of the other baits, is detected. 100521 Twenty-six out of 29 double positive prey clones encode the gene for 10 pl1. p11 interacts with 5-HThs receptors in this assay but not with 5-HT , 5-HT2A, 5-HTsA, 5-HT, dopamine D, or dopamine Da receptors, two irrelevant baits (Cdeltal 15 and pRP2 1), or the empty plasmid, showing the specificity of p11's association with 5-HT 1 1 receptor. 15 Example 2 - Co-immunoprecipitation. 100531 HeLa cells, which contain endogenous p1 (Si), are grown in DMEM medium to 60% confluence and transfected withpcDNA3. 1-5-HTIBR-V5 or empty plasraid constructs with Lipofectamine according to the manufacturers protocol. After transfection, cell extracts are solubilized at 4*C (in 50 mM Tris, pH 7.4/150 20 mM NaC/2 mM EDTA/2 mM EOTA/0.1% Triton and protease inhibitors). Cell extracts are Immunoprecipitated with anti-V5 monoclonal antibody, Incubated with protein G and thoroughly washed. In other experiments, brain tissue from cerebral cortex of wild-type and p11 KO mice is homogenized in solubilization buffer at 4*C. Brain extracts are immunoprecipitated with a polyclonal 5-HTIB receptor antibody, 25 incubated with protein A and thoroughly washed. The immunoprecipitates fromf the cells and the brain tissue are run out on an SDS-PAGE gel and transferred onto PVDF membranes. Immunoblotting is carried out using a mouse monoclonal antibody against ph1 (1/100). Antibody binding is detected by incubation with a secondary HRP-linked antibody directed towards mouse IgG and enhanced chemiluminescence. 30 {00541 pl coimmunoprecipitates with 5-HTs receptors in HeLa cells and brain tissue. Example 3 - Immunofluorescence. 29 [0055] HeLa cells are transfected withpcDNA3.1-5- HTIBR or pcDNA3.1-V5 constructs. Thirty six hours posttransfection cells are fixed with 4% paraformaldehyde/0.01 M PBS for 10 min. Non-specific staining is blocked by incubation with 10% BSA in PBS. 5-HTia receptors and p11 are visualized by 5 incubation with anti-VS-FITC antibody (1/500) and anti-mouse p1 I antibody (1/1000) followed by Alexa Fluor 568-labeled goat anti-mouse secondary antibodies (1/500). After washing in PBS, cover slips are mounted on slides by using Gel/Mount. Images of fluorescent proteins are acquired using a laser-scanning microscope. (00561 Immunofluorescence shows a prominent colocalization between pi1 and 10 5-HTi1 receptors at the cell surface. Example 4 - In situ hybridization experiments. [00571 AD animal experiments are performed according to guidelines from institutional animal care committees at the Rockefeller University, the Karolinska 15 Institute and the National Institutes of Health. Brains from adult male Sprague Dawley rats are used to determine the regional distribution of p I gene expression and its co-distribution with 5-HTIB receptor gene expression. For some experiments, brains from p11 KO mice and their wild-type counterparts are used. To study the effects of psychoactive drug treatment on p 1 l mRNA expression, wild-type adult 20 male C57B16 mice are treated with a single InJection or repeated injections (once daily for 14 days) of, vehicle, imipramine (10 mg/kg, i.p.), haloperidol (1 mg/kg, i.p.), diazepam (5 mg/kg, L.p), tranylcypromine (10 mg/kg, i.p.) or risperidone (1 mg/kg, i.p.). Animals are killed I hour after the last injection. To study the effect of electroconvulsive treatment (ECT) on p11 expression, male Spraque Dawley rats (200 25 gram) are exposed to daily ECT via ear clip electrodes (45 mA; 0.3 sec) for 10 days and killed 18 hours after the last stimulation. Control animals received sham treatment In which electrodes are clipped onto the rat ears but no current Is applied. [0058] There is an upregulation of pl I mRNA In the forebrain following the 14 day treatment with imipranine and with tranylcypromine, and following the repeated 30 electroconvulsive therapy, but not with haloperidol, risperidone, or diazepam. Example 5 - p11 protein levels in mouse depression model and In normal and depressed humans. 30 10059) Wild-type adult male C57B16 mice are treated once daily for 14 days with vehicle or imipraxmine (10 mg/kg, i.p.) and killed 1 hour after the last injection. Male Spraque Dawley rats are exposed to daily ECT via ear clip electrodes (45 mA; 0.3 se) for 10 days and killed 18 hours after the last stimulation. Adult female 5 helpless H/Rouen mice and non-helpless NH/Rouen mice are sacrificed. From these 3 different treatment groups and their corresponding controls, frontal cortices are dissected out and frozen. [0060] Fresh-frozen tissue from the human cingulate cortex of normal controls and patients who suffered frorn major depression Is obtained from the Stanley 10 Foundation Neuropathology Consortium. The frozen cortices are sonicated in 1% SDS and boiled for 10 min. Small aliquots of the homogenate are retained for protein determination by the bicinchoninic acid protein assay method. {00611 Equal amounts of protein are processed by using 10-20% gradient acrylamide gels. Immunoblotting is carried out with either polyclonal or monoclonal 15 antibodies against p11 (111000 fbr the human samples and 1/200 for the rodent samples) and polyclonal antisem against satin (1/1'000). Antibody binding is detected by enhanced chemiluminescence and quantified by densitometry, using National Institutes of Health IMAGE 1.63 software. The level of pl I is normalized to the level of action. All data are presented as normalized levels. 20 10062] To study the regulation of p11 mRNA in a genetic mouse model of depression, forebrain tissue from adult female and male helpless H/Rouen mice and from non-helpless NH/Rouen mice are compared. ph1 mRNA and protein are markedly lower in H/Rouen mice. Similar results are found with the two genders. {0063) Forty-sm-thick cryostat-cut sections of human cingulated cortex of 25 normal controls and patients who suffered from major depression are obtained from the Stanley Foundation Neuropathology Consortium. The analyzed samples are from both genders (6 females and 9 males in both the normal and depression groups) and aged 29-68 (normal) and 30-65 (depression) years. The duration of the disease among the depressed patients varies from 1 to 42 years. Seven of the depressed individuals 30 died by suicide. The post-mortem intervals of the braintissue before it is frozen are 8 42 (normal) and 7-47 (depression) hours and the pH of the tissue 5.8-6.6 (normal) and 5.9-6.5 (depression). In .itu hybridization probes are made by PCR amplification of nucleotides 1159-1420 of the coding sequence of the rat 5-HTIB receptor gene, 31 nucleotides 1-293 of the coding sequence of the mouse or human p11 genes and nucleotides 1-287 of the coding sequence of the rat p11 gene, respectively. The different PCR fragments are subcioned into the pCRII-TOPO vector. With the exception of the studies on human tissue, 12-pm-thick cryostat sections are made for 5 all studies. Sections are hybridized with [D-S]UTP-labeled riboprobe repared by In vitro transcription from cDNA corresponding to the rat 5-HT1B receptor gene or mouse, rat or human p1 I gene as previously described (S). After hybridization, the sections ae exposed to Biomax MR film for 7 to 24 days and analyzed using the NIH Image 1.63 software. Unless indicated, analyses are made in the prelimbic/anterior 10 cingulate cortex. Some sections are dipped into Ilford KS emulsion for cellular analysis. After 8 weeks, the sections are developed, Nissl-stained and mounted. [00641 Similar to the H/Rouen mice, p11 mRNA and protein are down regulated in the anterior cingulate cortex in patients who had suffered from unipolar major depression disorder. 15 Example 6- p11 / 5-HT1, receptor co-transfection experiment. [0065] COS 7 cells, which contain low, if any, native p11, am transfected with pI1 (pcDNA3.1-pl 1), with 5-HTia (pcDNA3.1-5-HT1BR-V5), with dopamine DI receptors (pcDNA3.1-DIR-V5), or empty plasmid. Plated COS 7 cells are incubated 20 with medium containing I mg/mI Sulfo-NHS-LC-Biotin for 30 min on Ice. Cells are Oinsed In TBS to quench the biotin reaction. Cells are lysed in 300 p of modified RIPA buffer (1% Triton X-100, 0.1% SDS, 0.5% deoxycholic acid, 50 mM NaPO4, 150 mM NaCI, 2 mM EDTA, 50 mM NaF, 10 mM sodium pyrophosphate. I mM sodium orthovanadate, 1 mM PMSP, and I mg/mi leupeptin). The homogenates are 25 centrifuged at 14,000g for 15 rmin at 4"C. Fifteen p of the supernatant are removed to measure total levels of 5-HT 1 , receptors. The remaining supernatant is incubated with 100 pl of 50% Neutravidin agarose for 3 hrs at 4"C and briefly centrifuged. Ie supernatant, containing cytosolic 5-HTma receptors, Is collected. Thereafter the agarose beads are washed 3 times with RIPA buffer and, after the final brief 30 centrifugation, bound proteins are resuspended in 40 pi of SDS sample buffer and boiled. Quantitative western blots are performed on total, cytosolic and biotinylated (surface) proteins using anti-V5 (to detect 5-HT11 receptors; 1:1000) and anti-p II (1: 1000) antibodies. Immunoreactive bands are detected by enhanced 32 chemilumninescence followed by autoradiography. The intensity of the bands is quantitated using NIH Image 1.63 software, The surface/total ratio is calculated for each well. Control experiments confirmed that the intracellular protein actin is not biotinylated in this assay. 5 [00661 Cells co-transfected with 5-HT 1 s receptors and pI1 exhibit more 5-HTis at the cell surface than cells transfected with 5-HTIB receptors alone. In contrast, the ratio of surface-to-total dopamine D, receptors is similar in the presence of absence of p1l. 10 Example 7 - cAMP measurements in COS 7 cells. 10067] COS 7 cells grown in DMEM medium are transfected with 5-HTIB receptors and/or p11. Thirty six hours later the cells are pretreated with theophylline (5 mM) and pargyline (10 sM) for 15 min. Vehicle or forskolin (10 sM) with or without serotonin (10 pM), is then added for another 15 minutes. At the end of the 15 treatment, the drug-containing medium is removed, the wells rinsed in PBS and the cells harvested. cAMP formation is quantitated by a direct cAMP enzyme immunoassay kit according to the manufacturers instructions. Control experiments show that serotonin does not alter cAMP formation in untransfected COS 7 cells. [0068] The ability of serotonin (10 mM) to counteract forskolin-induced cAMP 20 formation in COS-7 cells transfected with the 5-HTID receptor Is increased in the presence of cotransfected p11. There is no significant difference in the cAMP responses to forskolin with or without p11. Data are normalized to forskolin stimulated conditions, with or without p11, and represent means T SEM. 25 Example 8 - Generation and analysis of trausgenle mice overexpressing p11. (0069] Transgenic mice with doxycycline-regulatable overexpression of p11 under the calcium/calmodulin-dependent protein kinase I (CarmKII) promoter are generated. Mouse p11 is fused with a Myc epitope tag using PCR and subcloned into the Sal I/Hind HI sites of pTet-splice (6). This plasmid (pTetOp-pl1-Myc) is 30 transfected into tTA-expressing CHO cells (kind gift from Dr Patrick Allen). The expression of Myc from extracts of these cells is confirmed by immunoblotting using an anti-Myc (1:1000) antibody. Afterthe confirmation that the p1 l-Myo is expressed, a DNA fragment (containing pTetOp-pl I-Myc, SV40 intron, and poly(A)+ signal) is 33 linearized, purified by electroelution and microinjected into the pronuclei of oocytes from C57BL6 mice and implanted in pseudopregnant C57BL6/CBA mice (Rockefeller University Transgenio Facility). Tall DNA is analyzed for the transgene by PCR (5'-TATAGTCGACATGATGCCATCCC AAATGO-3 and 5' 5 TATAAAGCTTCTAC AAATCTITCTTCAGAAATCAATIT TGTrCAGATTCTTCCCCTTCTG-3'). Founder mice positive for the pTetOp-pl I Mye construct are crossbred with C57B16 mice to generate F I mice. F2 homozygous pTetOp-pl I-Myc-transgenic mice are obtained by crossbreeding Fl siblings. (The homozygous genotype Is confirmed by crossbreeding them with wild-type mice.) 10 These mice are crossbred with C57B16 mice expressing tTA under the CamKll promoter (S7). The mice are genotyped by-PCR with the abovementioned primers (to detect pi -Myc) and 5'- GAGCTOCTTAATOAGOTCG OAATC-3' and 5' TCTAAAGGGCAAAAGTGAGTATGO-3' (to detect tTA). The overexpression of p 11-Myc in double transgenic mice Is confirmed by immunoblotting using an anti 15 Myc antibody and by in sltu hybrization against the mouse p11 gene (Fig. S2). The expression of CamKH-driven (TA is detected using In situ hybrization with a riboprobe against the coding region of tTA (kind gift from Dr Alexei Morozov, Columbia University) (Fig. S2). In the behavioral experiments, double transgenic mice are compared with littermates expressing none or one the transgenes serving as 20 control mice. Some double transgenic mice receive doxycycline 50 mg/1 in their drinking water for 18 days before the experiment. 10070] In the absenceof doxycycline, transgenic mice have elevated p11 in neurons that do not contain serotonin in the forebrain, but not in serotonin neurons in the rape nuclei. These mice have increased functional 5-HT 1 9 receptors in substantia 25 nigra, and exhibit reduced thigmotaxis (an index of anxiety-related distress) and Increased horizontal activity in the open-field test. They also show a decreased immobility in the tail suspension test (an index of depression-like state). Thus, mice overexpressing p11 act as If they weretreated with antidepressants, although a confounding factor is that they appear to be generally hyperactive. Transgenic mice 30 treated with doxycycline have normalized p11 expression (fig. S4) and no significant alterations of thigmotaxis, immobility, or horizontal activities. Example 9: Generation and analysis of p11 knock-out mice 34 [0071] Generation and analysis of p11 KO mice. Using a probe from the coding sequence of rat p11. 6 genomic clones are isolated from a BAC library screen. A 13.7-kb Bam HI fragment is subeloned from a BAC Clone and mapped by restriction enzyme analysis. The mouse p 1 1 gene contains an ATO-containing exon, a 5 3.5-kb Intron, followed by another exon with the stop codon. A 11.3 kb targeting vector (5' Hinc IH-Bgl I + (Barn H1-loxPNeoloxP-Kpn I]+Apa I*-Eco RV 3') spanning the ATO-containing exon ofthe p1l gene is made in pBSK(-) (Fig. SS). The targeting vector is electroporated into 129SvEv ES cells and selected for recombinant clones by 0418. ES clones are identified as positive for homologous 10 recombination by southern blotting using 5' and 3'extcrnal probes (300-bp Bam HI/Bsp MI fragment and 285-bp Barn HI/Sca I fragment, respectively) in an analysis of ES cell DNA digested with Spe I and Bam HI/Sal I, respectively. Positive clones are injected into C57BL/6 blastocysts, and chimeric males are bred with C57BU6 females to obtain germ-line tansmission. Heterozygous of~pring are mated to 15 generate knockout and wild-type mice. Southern blotting from tail DNA confirmed that both alleles are mutated in p I KO mice (Fig. S5). The absence of the p1 1 gene in the pl I knockout mice is further confirmed using In situ hybridization with a probe against the mouse p1 I gene (Fig. S5). A PCR procedure, using the following oligonucleotides, 5'-CATTCAGAGOTOAACCCTOCTGAGOO-3', 5' 20 CCTOTCAGCCACTCTATAT GCTCCTAATC-3'and 5' GOCCAGCTCATTCCTCCC ACTCATO-3', is developed to distinguish wild-type, heterozygote and knockout mice (Fig. S5). This PCR-based approach is used for routine genotyping. Except for studies with primary cortical cultures, all experiments are perfomed on p11 KO and wild-type littermates generated from heterozygote . 25 breeding. The heterozygote x heterozygote breeding yielded 29% wild-type, 53% pI 1 heterozygote and 18% p I KO mice. It is unclear why there are fewer KO mice, but p11 has been found to be involved in early embryonic implantation (S8). Heterozygote p11 mice are backcrossed for two generations with C57B16 mice. Microsatellite genotyping, using 104 specific C57B16 markers (Rockefeller 30 University Gcnomics Resource Center), shows that heterozygote pIl mice used for breeding of experimental animals ae on a 74 + 2.8 % C57B16 background. (00721 Quantitative receptor autoradlography. Cryostat sections (12 sm thick) are made from p11 KO and wild-type mice. 5-HTIB receptors are detected by 35 incubating the sections in 170mM Tris/150mM NaCI pH 7.4 (25C) containing the antagonist [' 25 1]cyanopindolol (0.3, 1,3, 10,30, 100 pM; 2200 Ci/mmol), 100 nM 8 OH-DPAT as a 5-HTIA blocker, and 30 pM isoproterenol, as 0-adrenergic receptor blocker, for two hours (S9). Non-specific binding is determined by measurements in 5 the presence of 100 pM serotonin. In displacement experiments, increasing concentrations of serotonin (0, 0.3, 1, 3, 10,30, 100, 300, 1000, 10000 nM) are incubated with 10 pM ['"]cyanopindolol as described above. 5-HT 1 9 receptors are also detected by incubating the sections in 9 170mM Tris/4mM CaCl2/0.1% ascorbic acid pH 7.4 (25"C) with the antagonist [ 3 H0R125743 (0.3, 1, 3, 10, 30 nM; 80 10 Ci/mmol; GE Healthcare) for two hours. Nonspecific binding is determined by measurements in the presence of 100 pM serotonin. 5-HTIA receptors are detected by incubating the sections in 50 mM Tris pH 7.4.4 mM CaC 2 , 1 mM MgC 2 and 0.1% bovine serum albumin (25*C) with agonist ( 3 H]8-hydroxy-2-(di-n-propylamino) tetralin ([ 3 H]8-OH-DPAT; 10 nM; 125 Ci/mmol; GE Healthcare), 300 nM SB IS 269970, as a 5-HT7 receptor blocker, for one hour. Non-specific binding Is determined by measurements in the presence of 100 pM serotonin, Di-like receptors are detected by incubating the sections in 25 mM Tris/100 mM NaCI/1 mM MgCh/l pM pargyllne/20 nM mianserin/0.001% ascorbic acid containing the antagonist [ 3 H)7 chloro-2,3,4,5-tetrahydro-3-methyl-5-phenyl-IH-3-benzazepine-7-oI ([ 3 H]SCH 20 23390; 2nM; 87.0 Ci/mmol) for 2 hours. Non-specific binding is determined by measurements in the presence of 100 pM SKF82958. D2-iike receptors are detected by incubating the sections with 170 mM Tris/120 mM NaCV5 mM KCI/2 mM CaCh,/1 mM MgC,/1 0 pM GTP/0.001% ascorbic acid containing the antagonist
[
3 Hjraclopride (5 nM; 72 Ci/mnmol) for one hour. Non-specific binding is determined 25 by measurements in the presence of 100 pM quinpirole. At the end of all autoradiographic experiments, sections are rinsed 2x5 min In their corresponding cold binding buffers, dipped In distilled water at 4 *C and dried under cold air. The sections are apposed to Biomax MR films for 3-5 days ([ 25 1]cyanopindolol) or 4-10 weeks ([ 3 H]GR125743, [ 3 H8-OHDPAT, 3H]SCH23390, [ 3 H]raclopride) together 30 with [mI] or [ 3 H] nicroscales. Optical density measurements are obtained in several brain regions with the NIH Image 1.63 image analysis system. Specific binding is calculated by digital subtraction of nonspecific labeling fom total binding. Standard curves generated from [ 3 H] or [N microscales are used to convert optical densities 36 into femtomoles per milligram of protein. Data obtained from saturation and displacement experiments are analyzed using non-linear regression equations. [00731 Autoradiographic ligand-binding experiments showed that there are fewer binding sites for the 5-HTIB receptor antagonist radioligands 5 ['I'f]iodocyanopindolol and [ 3 H]GR125743 In globus pallidus In p11 KO than in wild-type mice. Similarly, ['N1]iodocyanopindolol binding is lower In substantia nigra pars reticulata in p11 KO than in wild-t mice (77.3& 5.8 versus 98.8*6.2 fmol/mg protein; P < 0.05 Student's t test). There is no difference in the affinity of serotonin to displace bound ['"Iiodocyanopindolol between wild-type and p11 KO 10 mice [median effective concentration (ECso) values: 57 verus 52 nM). No differences In the amounts of 5-HTIA, D:, or Dz receptors are detected between the wild-type and pl I KO mice. ['Nl]Iodocyanopindolol binding Is also reduced in H/Rouen mice versus NH/Rouen mice. (00741 ["S]GTPyS binding In response to 5-HTlA or 5-HTIB receptor 15 stimulation. Fresh cryostat sections (12 Im) from wild-type, p1 I KO and p I transgenic mice are preincubated for 30 min in Tris-HCI 50 mM (pH 7.4) supplemented with 100 mM NaCl, l0 3 mM MgCl2, 0.2 mM EGTA, 2 mM GDP and I U/mi adenosine deaminase to remove endogenous adenosine. The sections are thereafter incubated for two hours at 25 *C in the same solution containing 40 pM 20 [S]GTP S, with (stimulation condition) or without (basal condition) 50 sM of the 5 HTIA receptor agonist, 8-OH-DPAT, or the 5-HTIB receptor agonist, anpirtoline. Non-specific labeling (background) is determined on autoradiographs from adjacent sections incubated with 10 pM of unlabeled GTP S. Sections are rinsed twice (3 min each) in 50 mM TrIs-HCl buffer, once (30 sec) in distilled water to remove the buffer 25 salts, and air-dried. 'he autoradiographs are obtained by 2-4 days exposure on Biomax MR film Optical density measurements are obtained in several brain regions with the NIH Image 1.63 image analysis system. (00751 The reduced number of 5-HTs receptors at the cell membrane In pl KO mice is reflected in a reduced ability of the 5-HTIa receptor agonist anpirtoline to 30 increase ["S]guanosine 5'-O-(3-thiotriphosphate (GTP-S) binding In globus pallidus in these mice. In contrast, there Is no difference in [MS]GTP--S binding by 8-OH DPAT [(+/-)-8-hydroxy-2-(di-n-propylamino) tetralin], a 5-HT :A receptor agonist, in wild-type and pt I KO mice (6.0 * 2.1 versus 5.0 * 2.0 optical density units). The 37 decreased number of fimctional 5-HT1f 1 receptors at the cell surface of pI1 KO mice is also reflected in a loss of ability of serotonin and of anpirtoline to down-regulate phospho,-'1zr2l"yr- ERKI/2 (extracellular signal-regulatedkinase) levels in primary cortical cultures from pII KO mice and of anpirtoline to decrease phospho 5 Ser-synapsin I, a site phosphorylated by cAMP-dependent protein Idnase, in striatal slices from p11 KO mice. [0076] Western blotting to detect phosphorylated ERK1/2 in primary cortical cultures. Cortices are removed from E18 mice generated from WT x WT or p1 iKO x p1 IKO breedings, trypsinized (0.25%), dissociated by trituration and plated 10 onto poly-L-lysine (1 mg/ml) coated six-well plates. The cultures (500,000 cells/mil) are grown in medium containing DMEM with 5% fetal bovine serum, 4 mM L glutamine, B-27 nutrient supplement, penicillin (5 U/mi), and streptomycin (Spg/ml). After two weeks, the cultures are treated with vehicle, serotonin (10 pM) or anpirtoline (10 pM) for 15 minutes. At the end of the treatment, the drug-containing 15 medium is removed, the wells rinsed in ice-cold PBS, the neurons removed by a cell scraper and frozen in liquid nitrogen. Frozen cell samples are sonicated in 1% SDS and boiled for 10 min. Small aliquots of the homogenate are retained for protein determination by the bicinchoninic acid protein assay method. Equal amounts of protein are processed by using 10% acrylamuide gels, as described (SI). 20 Immunoblotting is carried out with a phospborylation-state-specifc antibody against phospho-'Ihr202/Tyr2O4-ERK1/2 or an antibody that is not phosphorylation-state specific against total ERK1/2. Antibody binding is detected by enhanced chemiluminescence and quantified by densitometry, using National Institutes of Health IMAGE 1.63 software. The level of the phosphorylated form of ERKI/2 is 25 normalized to its total level. All data are presented as normalized levels. 100771 Western blotting to detect phosphorylated synapsin I In brain slices. Slices (300 sm) from the striatum are prepared from wild-type and p11 KO mice as described (S10). The slices are preincubated in Krebs buffer (118 mM NaC/4.7 mM KCI/1.5 mM Mg2SO4/1.2 mM KH2PO4/25 mM NaHCO3/11.7 mM glucose/1.3 mM 30 CaCI2) at 30 0 C under constant oxygenation (95% 02/5% C02) for 60 min, with a change of buffer after 30 min. Slices are treated with vehicle or anpirtoline (50 pM) for 2 min. After drug treatment, the buffer Is removed, the slices are rapidly frozen on dry ice, sonicated in 1% SDS and boiled for 10 min. Small aliquots of the homogenate 38 are retained for protein determination by the bicinchoninic acid protein assay method. Equal amounts of protein are processed by using 10% acrylamide gels. Immunoblotting is carried out with a phosphorylation-state-specific rabbit polyclonal antibody against phospho-Ser9-synapsin I, a site that Is phosphorylated by PKA and 5 CamKU, or a rabbit polyclonal synapsin antibody that is not phosphorylation-state specific. Antibody binding is detected by enhanced cbemiluminescence and quantified by densitometry, using National Institutes of Health IMAGE 1.63 software. The level of the phosphorylated form of synapsin is normalized to its total level. All data arm presented as normalized levels. 10 (0078) Electrophysiology. Male pII KO and wild-type mice (4-7 weeks old) are decapitated under fluorothane anesthesia. Their brains are rapidly removed and coronal brain slices (400 pm thick), containing the nucleus accumbens, are prepared with a microslicer. Slices are incubated, for at least I h, at 32*C in oxygenated (95% 02+5% C02) artificial cerebrospinal fluid (aCSF) containing (in mM): 126 NaCl, 15 2.5 KCI, 1.2 NaH2PO4, 1.3 MgCI2, 2.4 CaCI2, 10 glucose and 26 NaHCO3, pH 7.4. Slices are transferred to a recording chamber mounted on an upright microscope and are continuously perfused with oxygenated aCSF at 28"C. Extracellular field potentials are recorded using a glass micropipette filled with aCSF positioned on the slice surface in the nucleus accumbens. Signals are amplified 500 times via an 20 Axopatch 200B amplifier acquired at 10kHz, filtered at 2kHz and recorded on a Computer using acquisition and pClamp9 data analysis software. Synaptic responses are evoked with a concentric bipolar stimulating electrode placed near the recording electrode on the surface of the slice. The dependence of the intensity of the stimulation applied to the slice on the fEPSP amplitude is similar in WT and p11 KO 25 mice, demonstrating that glutamatergic 12 synaptic transmission did not differ between WT and p11 KO mice. Single stimuli (0.1 ms duration) are applied every 15 se at an intensity yielding 50-70 % maximal response as assessed by a stimulus/response curve established for each slice examined by measuring the amplitude of the field potential evoked by increasing stimulus intensities. To evaluate 30 the effect of serotonin receptor activation on glutamatergic synaptic transmission, serotonin is applied in the perfusion solution while measuring fEPSP/PS amplitude. Serotonin (50 pM; In the presence of 10 pM fluoxetine) depresses the amplitude of the fEPSP/PS In slices from WT mice (72 002.7 % of baseline value) and this effect 39 is abolished in slices from pl 1 KO mice (98 003.6 % of baseline value). Numerical values are expressed as means 0 OSEM. Drugs are applied in the perfusion solution by switching a three-way tap. [00791 Serotonin, via 5-HT 18 receptors, reduces glutamate release at terminals 5 of neurons originating from the cerebral cortex and inhibits synaptic transnission at . corticostriatal synapses. The amplitude of field excitatory postsynaptic potentials (f . EPSPs) evoked by brief electrical stimulation of glutamatergic fibers and recorded extracellularIy in the nucleus accumbens is monitored. f EPSPs are mediated by AMPA receptors activated by endogenous glutamate released by electrical stimulation 10 ofthe slice in both wild-type and pII KO mice [f EPSP/population spike (PS) reduction 77 and 81%, respectively, compared with baseline, 15 min after the AMPA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX)]. When applied in the perfusion solution, serotonin depresses the amplitude of the f EPSP/PS In slices from wild-type mice, but not from pI I KO mice. 15 [0080] Tissue content of monoamines and metabolites. Male p I1 KO, pI1 heterozygote and wild-type mice (n -8 per genotype) are sacrificed by focused microwave irradiation and striata, cortices and hippocampi dissected out and frozen on dry ice. The tissue samples are then sonicated in 10 volumes of 0. IN TCA, vortexed and centrifuged at 12,000g for 2 min. Supernatants are collected and 20 analyzed for serotonin and the serotonin metabolite 5-hydroxyindolacetic acid (5 HIAA) using HPLC coupled with electrochemical detection (HPLC-EC). Serotonin and 5-HIAA are separated with a base deactivated silica-Hypersil 5 pm C18 analytical column (4.6 x 150 mm) with a mobile phase consisting of 75 mM sodium phosphate monobasic, 350 mg/L 1-octanesulfonic acid sodium salt, 0.5 mM EDTA, 0.8% 25 tetrahydrofuran (HPLC grade, inhibitor-free), and 8% acetonitrile, pH 3 (adjusted with phosphoric acid), at a flow rate of 1.2 ml/min. An electrochemical detector with dual glassy carbon electrodes is used (electrode I =680 mV, range, 0.5 nA; electrode 2= -100 mV, range, 0.2 nA). Data are collected using EZChrom software that calculated peak heights and sample concentrations. The sensitivity for serotonin and 30 5-HIAA is 0.1 pmol/ml, 100811 5-HT,1 receptors act as autoreceptors and inhibit serotonin release. Because p11 is expressed in the raphe nuclei, the amounts of serotonin and its major metabolite 5-hydroxyindoleacetic acid (5-HIAA) are measured in projection areas, 40 namely, cortex, striatun, and hippocampus in wild-type and p11 KO mice. In acordance with a negative regulation of 5-HT turnover and/or metabolismby 5-HTa receptors, and a potentiating role of plI on 5-HT11 receptor function, plI KO mice have increased levels of serotonin turnover and/or metabolism. 5 100821 Behavioral analyses - Open-field analysis. Horizontal activities are measured for 30 minutes (results are analyzed every 5 min period) during daytime in a fully computerized, multicage, red and infrared-sensitive motion detection system. The peripheral activity values are divided 13 by the total horizontal activity values to determine thigmotaxis. In experiments with anpirtoline (5 mg/kg, Lp.) animals are 10 tested 15 min postinjection. Some anpirtolinetreated mice had received daily injections with imipramine (10 mg/kg, i.p.) for 4 weeks until the day before the experiment. [0083] Behavioral analyses - Tail Suspension Test. The tail suspension test, a model of antidepressant-like activity, is carried out as described (SI)) and is a 15 modified version of that validated for C57B16 (S)2) and NMRI miee ($13). Mice are individually suspended by the tail to a horizontal bar (distance from floor is 35 cm) using adhesive tape (distance from tip of tail is 2 cm). Typically, mice demonstrated several escape-oriented behaviors interspersed with temporally increasing bouts of immobility. A 6-min test session is videotaped and scored by an observer who is 20 unaware of the genotype. The parameter recorded is the number of seconds spent immobile. In experiments with anpirtoline (5 mg/kg) and Imipramine (10 mg/kg), animal are tested 15 minutes postinjection. [0084] Behavioral analyses - Sucrose Consumption Test. A single bottle procedure in individually housed p11 KO mice and wild-type mice is used for testing 25 sucrose consumption. Consumption of a 2% sucrose solution in water is measured during a 96-hour period. In a subsequent experiment, water intake is measured for the same period of time. [0085] To evaluate behavioral effects of pl1 deletion, thigmotaxis in wild-type and p11 KO mice is compared under basal conditions and in response to anpirtoline in 30 drug-naive mice and in mice that have been treated long-term with imipramine. In animals treated with imipramine, anpirtoline causes a significant reduction in thigmotaxis in wild-type mice, but not in piI KO mice (Eig. 4. In addition, there is less thiginotaxis in saline-injeeted wild-type than pl KO mice Ci. 4) Drug-narve 41 wild-type and p11 KO mice exhibit similar thigmotaxis either in the absence or presence of anpirtoline. There is an increased immobility in the tail suspension test in p1I KO mice compared with wild-type mice, both under baseline conditions and after acute treatment with either anpirtoline or Imipramine (Fig. . These behavioral 5 results indicate that p11 KO mice exhibit a depression-like phenotype and that p1 mediates behavioral responses to imipramine via 5-HT 9 receptors. In further support of a depression-like phenotype of pIl KO mice, p11 KO mice consume less of a palatable 2% sucrose solution than their wild-type littermates (1.74 * 0.07 versus 2.17 *0.11 ml/g body weight per day; P <0.05 Student's t test), which indicates a 10 decreased responsiveness to sweet reward. Water intake is similar In the p iI KO mice and their wild-type littermats (1.51*0.05 versus 1.42 * 0.05 ml/g body weight per day), which rules out a role of altered fluid balance in this behavior. Example 10: Detection of p11 In human peripheral blood mononuclear cells 15 (PBMC) [0086 Whole blood(l0-15 ml) is collected in a heparinized tube. One ml of blood will yield approximately 1 mij mononuclear cells, although the number varies considerably between individuals. The blood is diluted) :1 in phosphate-based saline (PBS). 2.S ml lymphoprep (Medinor cat nr 1114547) is added to 15 m tubes andlO 20 ml diluted blood carefully layered on top. The tubes are spun 20 minutes ati 800 rpm and room temperature. Using a Pasteur pipette, PBMC are collected from two tubes into one clean 15 ml tube This tube is filled with PBS and spun down at 1500 rpm for 10 minutes. "Te cells are then washed twice In PBS (removes blood platelets as well as lymphoprep). To count, PBMC are diluted In 1 ml of medium (90% fetal calf 25 serum/10% DMSO) per original 10 ml whole blood volume. (Count diluting 1:10 in Trypan Blue). PBMC are frozen at -80C (dry ice) or cooler, and stored it and delivered at -80"C. 0.5 milj PBMC per well are added to 96-well plates. The plate is spun and the supernatant discarded. The cells are fixed in BD fixation buffer (BD Biosciences, from kit cat no 554715). The permeabilisation buffer from the same kit 30 is added and the cells are washed. The cells are now ready for intracellular staining. p1I antibody (BD Biosciences; 2,5ug/ml) ih diluted in the permeabilisation buffer and added to the wells. One well is used for IgG1 control. The cells are suspended by pipetting. The cells are incubated for 30 minutes and washed In permeabilization 42 buffer. The secondary antibody (ex goat anti-mouse PE coqJugated) is diluted in permeablization buffer and added to each well. The cells are suspended and incubated for 30 minutes. They are washed twice with permeabilizaton buffer and once with PBS-1% FCS. For doublestaining, the secondary antibody is blocked by 5 washing once with 100ul PBS-1%FCS-l%NMS (normal mouse serum). The blocking step is necessary to avoid binding of subsequent antibodies to any remaining secondary antibody. To stain surface markers, PBS containing CD14-PerCP (to distinguish monocytes) or CD3-PerCP and CD56-PE (to distinguish T cells and NK cells), or CD19-FITC (to distinguish B cells) Is added to each well. The cells are 10 suspended by pipetting and incubated 10 minutes in the refrigerator. They are then washed once with 200ul PBS-l% FCS. Standard FACS procedure is used to determine the staining of p1 1 in the different types of mononuclear cells. p11 is highly expressed in some white blood cells, monocytes, NK killer cells and CD-8 positive T-cells. 15 43

权利要求:
Claims (39)
[1] 1. A method of diagnosing a p 1/5-HT receptor related disorders in a subject comprising determining the level of p 1 1 in a biological sample from said subject and comparing said p11 level to a reference, wherein an abnormal level of pl 1 compared to the reference constitutes a positive diagnosis of p1 1/5-HT receptor related disorder.
[2] 2. A method according to claim 1, wherein said pl 1/5-HT receptor related disorder is a disorder associated with an abnormally low level of p 1 1, wherein a reduced level of p 1 1 in a subject compared to a control subject constitutes a positive diagnosis of such disorders.
[3] 3. A method according to claim 2, wherein said disorder associated with an abnormally low level of pI 1 is selected from a group consisting of depression, obsessive compulsive disorder, drug addiction, eating disorders, Alzheimer's disease, attention deficit disorder and attention deficit hyperactive disorder.
[4] 4. A method according to claim 2, wherein said disorder associated with an abnormally low level of p1 1 is depression.
[5] 5. A method according to claim 1, wherein said pl 1/5-HT receptor related disorders are disorders associated with an abnormally high level of p11, wherein an elevated level of pl1 in a subject compared to that in a control subject constitutes a positive diagnosis of such disorders.
[6] 6. A method according to claim 5, wherein said disorder associated with an abnormally high level of pl is selected from a group consisting of mania, dipolar disorder, anxiety disorders, aggression, sleep disorders, sexual dysfunction and gastrointestinal disorders.
[7] 7. The method according to any of the preceding claims, wherein said level of pl 1 is determined by assaying pl1 protein level in the monocytes and/or lymphocytes in said biological sample from said subject.
[8] 8. The method according to any of the preceding claims, wherein said level of pl is determined by assaying p11 mRNA level in a biological sample from said subject.
[9] 9. A method to identify modulators useful to treat or ameliorate pl 1/5-HT receptor related disorders comprising the steps of: a) providing a first sample and a second sample containing equivalent amounts of pl 1 gene product; b) contacting the first sample with the candidate p11 modulator; and 44 c) determining whether the amounts of p 1 1 gene product in the first sample has increased or decreased relative to the amounts of p1 gene product in the second sample not contacted with the candidate pl1 modulator, wherein an increased amount of gene product indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level of pl1 while a decreased amount of gene products indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally high level of pl1.
[10] 10. A method to identify modulators useful to treat or ameliorate p1 1/5-HT receptor related disorders comprising the steps of: a) providing a first sample and a second sample containing equivalent number of 5-HT 1 B receptors at cell surface; b) contacting the first sample with the candidate pl1 modulator; and c) determining whether the number of 5-HTlB receptors at cell surface of the first sample has increased relative to the second sample, wherein an increased number of 5-HT B receptors at cell surface indicate that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally low level of pl 1 activity while a decreased amount of 5-HTIB receptors at cell surface indicates that the candidate modulators can be useful to treat or ameliorate disorders associated with abnormally high level of p1 1 activity.
[11] 11. The method according to claim 9 or 10, wherein said modulators are useful to treat or ameliorate p1 1/5-HT receptor related disorders selected from a group consisting of depression, obsessive compulsive disorder, drug addiction, eating disorders, Alzheimer's disease, attention deficit disorder or attention deficit hyperactive disorder, comprising assaying for the ability of said candidate modulator to up regulate p1 1 expression.
[12] 12. The method according to claim 11, wherein said p1 1/5-HT receptor related disorder is depression.
[13] 13. The method according to claim 9, 10, 11, or 12 wherein the p 1 1 modulator is a tricyclic antidepressant, a serotonin reuptake inhibitor or a monoamine oxidase inhibitor.
[14] 14. A method to identify p 1 I mimetics useful to treat or ameliorate pl 1/5-HT receptor related disorders comprising assaying for the ability of a candidate pI 1 mimetic to recruit 5-HTIB receptors to the neuronal plasma membrane. 45
[15] 15. A method according to claim 14, wherein said pl1 mimetics are useful to treat or ameliorate disorders associated with abnormally low level of pl1, wherein said candidate p1 mimetics recruit 5-HTIB receptors to the neuronal plasma membrane.
[16] 16. A method according to claim 15, wherein said disorder is selected from a group consisting of depression, obsessive compulsive disorder, drug addiction, eating disorders, Alzheimer's disease, attention deficit disorder and attention deficit hyperactive disorder.
[17] 17. A method according to claim 16, wherein said disorder is depression.
[18] 18. A method of treating or ameliorating pl 1 dysfunction in a subject diagnosed as suffering from one or more pl 1/5-HT receptor related disorders comprising administering to said subject a therapeutically effective amount of a pi I modulator or pl 1 mimetic.
[19] 19. A method according to claim 18, wherein pll/5-HT receptor related disorder is selected from a group consisting of depression, obsessive compulsive disorder, drug addiction, eating disorders, Alzheimer's disease, attention deficit disorder and attention deficit hyperactive disorder, comprising administering to said subject a therapeutically effective amount of a p 1 1 modulator or mimetic, wherein said pl1 modulator or mimetic up regulate pl 1 expression or recruits 5-HTIB receptors to the neuronal plasma membrane.
[20] 20. A method according to claim 19, wherein said pl 1/5-HT receptor related disorder is depression.
[21] 21. A method according to claim 18, wherein pl 1/5-HT receptor related disorder is selected from a group consisting of mania, dipolar disorder, anxiety disorders, aggression, sleep disorders, sexual dysfunction and gastrointestinal disorders, comprising administering to said subject a therapeutically effective amount of a pl 1 modulator or mimetic, wherein said p 1 1 modulator or mimetic inhibit p 1 I expression or down-regulate 5-HTIB receptors at the neuronal plasma membrane.
[22] 22. A pl1 knock-out non-human mammal wherein said mammal has a defect, mutation or deficiency in the p 1 1 gene compared to wild-type mammals of the same species.
[23] 23. The p 1 1 knockout non-human mammal which is a mouse.
[24] 24. A knock-out mouse according to claim 23, wherein said mouse under-expresses p 1 1 proteins compared to wild-type mice.
[25] 25. A mouse according to claim 23, wherein said mouse has fewer 5-HTIB receptors at the neuronal plasma membrane compared to wild-type mice. 46
[26] 26. A mouse according to any of claims 23, 24 or 25, wherein said mouse exhibits a depression-like phenotype.
[27] 27. A method of studying p1 1/5-HT receptor related disorders or to develop novel psychotherapeutic agents useful for the treatment of pl 1/5-HT receptor related disorders comprising: a) administering an effective amount of said psychotropic agent to pl 1 knock-out mice and control mice; b) assessing the levels of p I1 level and/or behavioral responses to said agent in said pI1 knock-out mice and control mice; c) comparing said pl 1 level and/or behavioral responses in p1 1 knock-out mice with control mice.
[28] 28. The method according to claim 27, wherein said p1 1/5-HT receptor related disorder is selected from a group consisting of depression, anxiety disorders, aggression, mania, bipolar disorder, sleep disorders, obsessive compulsive disorder, drug addiction, eating disorders, sexual dysfunction, Alzheimer's disease, attention deficit disorder, attention deficit hyperactive disorder and gastrointestinal disorders.
[29] 29. A non-human mammal comprising a transgene encoding p1 under control of a regulatable promoter.
[30] 30. The mammal of claim 29 which is a mouse.
[31] 31. The mammal of claim 29 or 30 wherein the promoter is a calmodulin/calmodulin dependent protein kinase II (CamKII) promoter.
[32] 32. A method to enhance pl 1 expression in a patient suffering from a p1 1/5-HT receptor related disorder, comprising the administration of a nucleic acid which enhances the expression of p1 1 in the brain of said patient.
[33] 33. The method of claim 32 wherein the nucleic acid encodes p 1 1.
[34] 34. The method of claims 32 or 33, wherein the p1 1/5-HT receptor related disorder is a disorder associated with abnormally low levels of pl selected from depression, obsessive compulsive disorder, drug addiction, eating disorders, attention deficit disorder or attention deficit hyperactive disorder, and Alzheimer's disease.
[35] 35. The method of any of claims 32-34, wherein the p1 1/5-HT receptor related disorder is depression. 47
[36] 36. The method of any of claims 32-35, wherein said nucleic acid is delivered by a recombinant, replication-deficient adenoviral vector comprising a DNA construct encoding p 1 1.
[37] 37. The method of claim 36 wherein said DNA construct is under the control of a neural tissue-specific promoter.
[38] 38. The method of any of claims 32-35, wherein said nucleic acid is delivered by a neural stem cell expressing p11 at levels higher than the levels expressed by the patient's brain cells.
[39] 39. The method of any of claims 32-38, wherein said nucleic acid encoding p11 is delivered to the hippocampus. 48

类似技术:

---

公开号 | 公开日 | 专利标题

---

US8470548B2|2013-06-25|Diagnosis of depression

---

Riccomagno et al.2012|The RacGAP β2-Chimaerin selectively mediates axonal pruning in the hippocampus

---

Gros-Louis et al.2008|Als2 mRNA splicing variants detected in KO mice rescue severe motor dysfunction phenotype in Als2 knock-down zebrafish

---

JP2009148278A|2009-07-09|Natural ligand of g protein conjugate type receptor chemr23, and use of the same

---

EP1888783B1|2011-10-26|Kcnn3 as diagnostic and therapeutic target for alzheimer&#39;s disease

---

Rong et al.2012|Comparison of Cbln1 and Cbln2 functions using transgenic and knockout mice

---

JP5053088B2|2012-10-17|Compositions and methods for diagnosis and treatment of epilepsy

---

Hashiguchi et al.2019|Ataxic phenotype with altered CaV3. 1 channel property in a mouse model for spinocerebellar ataxia 42

---

US6475744B1|2002-11-05|Methods for identifying compounds which modulate circadian rhythm

---

Ravary et al.2001|Abnormal trafficking and subcellular localization of an N‐terminally truncated serotonin transporter protein

---

JP2000511410A|2000-09-05|Mammalian regulators of nonsense-mediated RNA decay

---

AU2013201088B2|2016-05-26|Novel therapeutic and diagnostic products and methods

---

JP2002523056A|2002-07-30|Homer interacting protein

---

JP2006516150A|2006-06-22|Method of treating Alzheimer&#39;s disease and composition therefor

---

JP2006288387A|2006-10-26|Method of ameliorating disease symptom caused by mood disturbance or related disturbance

---

JP2006320201A|2006-11-30|Method for ameliorating disease symptom caused by mood disorder or related disorder

---

US20120149645A1|2012-06-14|Compositions and modulation of myocyte enhancer factor 2 |

---

WO2001016315A1|2001-03-08|sIGH AFFINITY CHOLINE TRANSPORTER

同族专利:

---

公开号 | 公开日

---

AU2013201088B2|2016-05-26|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
2016-09-22| FGA| Letters patent sealed or granted (standard patent)|

优先权:

---

申请号 | 申请日 | 专利标题

---

US60/813,170||2006-06-13||

---

US60/878,730||2007-01-05||

---

AU2007258233A|AU2007258233B2|2006-06-13|2007-06-13|Novel therapeutic and diagnostic products and methods|

---

AU2013201088A|AU2013201088B2|2006-06-13|2013-02-22|Novel therapeutic and diagnostic products and methods|AU2013201088A| AU2013201088B2|2006-06-13|2013-02-22|Novel therapeutic and diagnostic products and methods|

---

AU2016219725A| AU2016219725A1|2006-06-13|2016-08-26|Novel therapeutic and diagnostic products and methods|